ID: 1152640433

View in Genome Browser
Species Human (GRCh38)
Location 17:81447163-81447185
Sequence CACAAGGACATTCCTGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152640414_1152640433 22 Left 1152640414 17:81447118-81447140 CCCTGAAACTATGCAAACCACCG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640421_1152640433 2 Left 1152640421 17:81447138-81447160 CCGCCCCGGGGGCCCAGCCTGAG 0: 1
1: 0
2: 3
3: 37
4: 356
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640423_1152640433 -2 Left 1152640423 17:81447142-81447164 CCCGGGGGCCCAGCCTGAGCCCA 0: 1
1: 1
2: 4
3: 66
4: 589
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640420_1152640433 5 Left 1152640420 17:81447135-81447157 CCACCGCCCCGGGGGCCCAGCCT 0: 1
1: 0
2: 3
3: 52
4: 578
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640424_1152640433 -3 Left 1152640424 17:81447143-81447165 CCGGGGGCCCAGCCTGAGCCCAC 0: 1
1: 0
2: 8
3: 70
4: 594
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640415_1152640433 21 Left 1152640415 17:81447119-81447141 CCTGAAACTATGCAAACCACCGC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640422_1152640433 -1 Left 1152640422 17:81447141-81447163 CCCCGGGGGCCCAGCCTGAGCCC 0: 1
1: 0
2: 8
3: 45
4: 465
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152640426_1152640433 -10 Left 1152640426 17:81447150-81447172 CCCAGCCTGAGCCCACAAGGACA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152640433 Original CRISPR CACAAGGACATTCCTGCCTG GGG Exonic
900540413 1:3199918-3199940 CACAAGGACATCCCTGTCCTGGG - Intronic
901115383 1:6839772-6839794 AGCAAGCACATTCCTGCCTCAGG - Intronic
902414385 1:16230321-16230343 CCCAGGGACATTCCTTCTTGGGG + Intergenic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
903137205 1:21317456-21317478 CACAAGGCCAGTCCAGCCCGCGG + Intronic
903296039 1:22343645-22343667 GCCAAGGACATTCCTGCCTCGGG - Intergenic
904356404 1:29942883-29942905 ACCAAGTACATTCCTGCCTCAGG - Intergenic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
907371485 1:54006419-54006441 GAAAAGGACATTCCAGGCTGAGG - Intergenic
908942749 1:69455227-69455249 CACAGGGACATGACTGCCTGAGG + Intergenic
909274791 1:73669300-73669322 CAAAAGAATATTTCTGCCTGTGG + Intergenic
915466620 1:156102161-156102183 CACAGGCACATTCCTCCCTTTGG - Intronic
916656820 1:166884175-166884197 CACAGGGAGAGTCCTTCCTGAGG - Intergenic
916706652 1:167357420-167357442 CACCACTACACTCCTGCCTGGGG - Intronic
922894072 1:229087476-229087498 CACAAGCACATGCCAGCATGTGG - Intergenic
1063133429 10:3197163-3197185 TCCAAGGACACCCCTGCCTGGGG - Intergenic
1064024641 10:11837659-11837681 CACAAGGTCATTACTGTCTTTGG - Intronic
1064030818 10:11881564-11881586 CACAAGGCCACACCTGGCTGTGG + Intergenic
1066502088 10:36004008-36004030 CGCAGGGACCCTCCTGCCTGGGG - Intergenic
1067127963 10:43536255-43536277 CTCAATGCCCTTCCTGCCTGGGG + Intergenic
1067243296 10:44515196-44515218 TCCAAGGACATCACTGCCTGTGG + Intergenic
1069646147 10:69999252-69999274 CACCAGTGCATTCCAGCCTGGGG + Intergenic
1071203636 10:83249643-83249665 TACAAGGACCCTCCTGCCTCAGG + Intergenic
1072531140 10:96320742-96320764 CAGAAGGAATTCCCTGCCTGGGG + Exonic
1075335447 10:121605938-121605960 CACAAACACATTCCTACCTTTGG + Intergenic
1075741314 10:124698160-124698182 CACAAGGAAATTACCCCCTGGGG + Intronic
1076271342 10:129155022-129155044 CACAGGGACATTCCAGGCTCAGG - Intergenic
1076416929 10:130297949-130297971 CCCAAGGAGATTCCTGTTTGTGG - Intergenic
1076917199 10:133430211-133430233 CTCAAGGAGATGCTTGCCTGTGG + Intergenic
1076937294 10:133574970-133574992 CTCAAGGAGATGCTTGCCTGTGG + Intergenic
1077210676 11:1369749-1369771 CTCCAGGAGCTTCCTGCCTGGGG + Intergenic
1077273452 11:1692573-1692595 CACAGGGCCTTGCCTGCCTGGGG - Intergenic
1079469598 11:20765632-20765654 CACAAGCTCCTTCCTGCCTTAGG - Intronic
1081814247 11:45929669-45929691 CACAAGGCCCTTCCTCCCTGAGG - Intronic
1083048790 11:59758557-59758579 CAGAAGGGCATCCCTTCCTGAGG + Intronic
1084096853 11:66917056-66917078 AACAAAAACATTCCTGCATGGGG - Intronic
1084283737 11:68118020-68118042 CAGAAGCACATTCCTGGGTGGGG + Intronic
1085299400 11:75449586-75449608 CACAGCGCCATTCCTGCATGTGG - Exonic
1085478243 11:76801362-76801384 CAGAGGGACATTCCTGCATTTGG - Intergenic
1085837739 11:79974515-79974537 CACAAGGACATTCATCCCCATGG + Intergenic
1086018693 11:82199197-82199219 CACATGTACATTCTTCCCTGTGG - Intergenic
1087209059 11:95427723-95427745 CACCACTACATTCCAGCCTGGGG + Intergenic
1088801643 11:113312562-113312584 CACAGTGACCTTCCAGCCTGTGG - Intergenic
1089429048 11:118405902-118405924 CACCATGACATTCCAGTCTGGGG - Intronic
1089973462 11:122712678-122712700 CACAGGTACCTTCCTACCTGTGG + Intronic
1090976709 11:131685517-131685539 GCCAAGCACATTCCTGCCTCAGG + Intronic
1091636124 12:2198179-2198201 CACAAGCACCTTGCTTCCTGAGG - Intronic
1091763418 12:3102735-3102757 CAAAAAAACATTCCTCCCTGGGG - Intronic
1092597522 12:10023608-10023630 CCCAAGAACATTCCTGCATTGGG + Intergenic
1093829452 12:23737756-23737778 CCCAAGGATATTCCTGCTTCTGG + Intronic
1094646615 12:32330762-32330784 CACAAGGACATGCTATCCTGGGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097447416 12:59689369-59689391 CACAAGGAAACTTCTGCCTCAGG + Exonic
1098908393 12:76184966-76184988 CACATGGACATTGGTGCGTGTGG - Intergenic
1101675869 12:106915685-106915707 TACAAGGCCATTCCCGCCTCTGG + Intergenic
1102962953 12:117105440-117105462 CACCACTGCATTCCTGCCTGGGG + Intergenic
1104137536 12:125954548-125954570 GCCAAGCCCATTCCTGCCTGCGG - Intergenic
1104481089 12:129109185-129109207 CACACGGCCATTCGGGCCTGGGG - Intronic
1105712176 13:23022056-23022078 CACAATGAATTTCATGCCTGTGG + Intergenic
1107242256 13:38250514-38250536 CACATGGACAGTCATGCCTCAGG + Intergenic
1107339065 13:39386787-39386809 CTCAAAGACATTTCTGACTGGGG + Intronic
1107649193 13:42527301-42527323 CAGAAGGCAACTCCTGCCTGAGG + Intergenic
1110090653 13:71443156-71443178 CTCATGGACATCCCTGCCTCTGG - Intronic
1111297070 13:86293469-86293491 TACAGGAACATACCTGCCTGGGG - Intergenic
1112999635 13:105619036-105619058 CACAATCACTTTCCTCCCTGAGG + Intergenic
1114073115 14:19131520-19131542 CGCCAGGACACTCCTCCCTGAGG + Intergenic
1114089151 14:19268463-19268485 CGCCAGGACACTCCTCCCTGAGG - Intergenic
1114692788 14:24600741-24600763 CCCAAGGACCCTCCTGCCTTGGG - Intergenic
1117980394 14:61337183-61337205 CACCACTACATTCCAGCCTGGGG - Intronic
1118166794 14:63344652-63344674 ACCAAGCACATTCCTGCCTTCGG + Intergenic
1120577003 14:86194873-86194895 CACAAGCACAAACCTGCCTCAGG + Intergenic
1121557496 14:94849405-94849427 CAAAGTGACATTCCTGCCTCCGG + Intergenic
1121670688 14:95708815-95708837 GGCAAGGAAATTCCTGTCTGTGG - Intergenic
1122706760 14:103626720-103626742 TCCAGGGTCATTCCTGCCTGAGG + Intronic
1122761671 14:104033348-104033370 CAGAAGCACAATACTGCCTGAGG - Intronic
1122875216 14:104660746-104660768 GACAGGGACGCTCCTGCCTGGGG + Intergenic
1126662723 15:51048386-51048408 TACAAGGCCATTCCTGTCAGGGG - Intergenic
1127116665 15:55734197-55734219 AAAAAGGATATTTCTGCCTGTGG - Intronic
1127909452 15:63404341-63404363 CACAAGGTCATTTCTGAATGAGG + Intergenic
1128127518 15:65204006-65204028 CACAGGCACATTCCTGCCTCAGG - Intronic
1129126223 15:73443352-73443374 CTCAGGGATATTCCTGCCTTCGG - Intronic
1129857884 15:78837912-78837934 GACTAGAACATTTCTGCCTGAGG - Intronic
1130541357 15:84822720-84822742 CACAAGGCCCATTCTGCCTGAGG - Intronic
1131986109 15:98044137-98044159 CAGAAGGACATCTCTGCCTCTGG - Intergenic
1132027623 15:98416624-98416646 TACCAGGAGATGCCTGCCTGGGG - Intergenic
1137897409 16:52228913-52228935 CAAAAGGACATCCCTTCCTCTGG + Intergenic
1138218505 16:55227175-55227197 CTCAAGGACCTTGGTGCCTGTGG - Intergenic
1140405486 16:74708151-74708173 CACAAGGAGAGTCCTCACTGAGG - Intergenic
1140406499 16:74714561-74714583 CCCAAGTTCATTCCTGCCTCAGG + Intronic
1140586253 16:76295857-76295879 CACCACTACATTCCAGCCTGGGG - Intronic
1142223409 16:88866060-88866082 GACAGGGACACTCCTTCCTGGGG + Intronic
1142401190 16:89859499-89859521 CAAAAGGAGATGCCTGCCTGAGG - Intronic
1143453969 17:7053865-7053887 CACAAAGGCATTTCTGCCTTGGG - Intergenic
1143653043 17:8276062-8276084 CACAAAGCCCTTCCTGCTTGGGG - Intergenic
1145966668 17:28923831-28923853 CACAAGAGCAGTGCTGCCTGTGG - Intronic
1146645507 17:34574503-34574525 ATCAAGCACATTCCTGCCTCAGG - Exonic
1148717716 17:49727773-49727795 GGCCAGGACTTTCCTGCCTGTGG - Intronic
1150649139 17:66998632-66998654 GACAAGGAGCTGCCTGCCTGGGG - Intronic
1151032530 17:70758050-70758072 CACAGGGACAGGGCTGCCTGTGG - Intergenic
1151558427 17:74858861-74858883 GATGAGGACATTCCAGCCTGGGG - Intronic
1152240688 17:79159350-79159372 CTCAGGGGCATGCCTGCCTGCGG + Intronic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1153836010 18:8964669-8964691 CACAATTTCATTCCTTCCTGAGG - Intergenic
1155155679 18:23155661-23155683 CACAAGGGTATTTCTGTCTGGGG + Intronic
1157171037 18:45405359-45405381 CACACGGAGACTCCTGACTGAGG - Intronic
1157389976 18:47293474-47293496 CACAAAGACATTCCTCCCATGGG - Intergenic
1157706225 18:49809160-49809182 CATAAGGTCTTTACTGCCTGCGG - Intronic
1158300455 18:56046558-56046580 CACAAGGACTTTCCAGCCTCTGG - Intergenic
1158482026 18:57830668-57830690 CACAAGCATGTTTCTGCCTGAGG - Intergenic
1158543454 18:58376870-58376892 CACAAGCCCCTTCCTGCCTCAGG + Intronic
1160223120 18:76991684-76991706 CAGAAATTCATTCCTGCCTGAGG - Intronic
1161060699 19:2213417-2213439 CTCAAGGACAGACATGCCTGAGG - Intronic
1162654468 19:12117890-12117912 CATAAGGAGAGTCCTGCCTTGGG + Intronic
1165757238 19:38301051-38301073 CACAGGCACATTCCTGCCTCAGG + Intronic
1166704963 19:44903470-44903492 CGCCAGGACACTCCTCCCTGAGG - Exonic
1166760901 19:45224086-45224108 AGCAAGTACATTCCTGCCTCAGG - Intronic
1166825196 19:45604456-45604478 CACAATGGCACTCCAGCCTGGGG - Intergenic
1166896065 19:46022578-46022600 CACAAGGTCATTTCTTCCTCGGG - Intronic
1166957524 19:46474823-46474845 CACCATGGCATTCCAGCCTGGGG + Intergenic
1167090961 19:47343440-47343462 CAGAAGGACATTCCAGCCAGTGG - Intergenic
1167487893 19:49773848-49773870 TACAAGCACAATCCTGCCTCAGG - Intronic
925133654 2:1511708-1511730 CATAAGGACATAGCTGCCTTGGG + Intronic
925755583 2:7128467-7128489 CAAAAGGAGAGTGCTGCCTGGGG - Intergenic
925900465 2:8505669-8505691 GACAAGGACATTCAGGCCTCGGG - Intergenic
929560692 2:42954610-42954632 CACGAGAACATTCCTGCTCGTGG - Intergenic
933970222 2:87463951-87463973 CACATGAACTTTCCTGCGTGGGG + Intergenic
934138504 2:89020754-89020776 CACAAGGAAAGTCCTCCCTAGGG + Intergenic
934230739 2:90179798-90179820 CACAAGGAAAGTCCTCCCTAGGG - Intergenic
936022479 2:109005432-109005454 CTCAGGGTCATTCCTGCCTCTGG + Intergenic
936323559 2:111486545-111486567 CACATGAACTTTCCTGCGTGGGG - Intergenic
938867163 2:135434213-135434235 CTCAGGGACAACCCTGCCTGAGG - Intronic
939595304 2:144115539-144115561 CACCAGGACATCGCTCCCTGTGG + Intronic
940862848 2:158788064-158788086 GACCAAGACATTCTTGCCTGTGG - Intergenic
942866604 2:180683812-180683834 CACTATGAGATTTCTGCCTGTGG - Intergenic
943560625 2:189457197-189457219 CACCATCACATTCCAGCCTGGGG + Intronic
946779445 2:223177976-223177998 CACAAGCACACTGCAGCCTGGGG - Intronic
948320573 2:237065566-237065588 CACCAGTCCATTCCTGCCTGTGG + Intergenic
948675616 2:239594889-239594911 CACCAGCACACTCCTTCCTGGGG - Intergenic
1168829648 20:838678-838700 CATAAGGTCTTTCCTGCCTCAGG - Intronic
1168932055 20:1631776-1631798 GCCAAGGAATTTCCTGCCTGTGG - Intronic
1168948429 20:1780363-1780385 CACCAAGCCCTTCCTGCCTGAGG - Intergenic
1168966722 20:1903116-1903138 TACAAGCTCATTCCTGCCTCAGG - Intronic
1168980430 20:1998894-1998916 ACCAAGCACATTCCTGCCTCGGG + Intergenic
1169288456 20:4328838-4328860 CACATGGACAGTCTCGCCTGTGG + Intergenic
1169614493 20:7424815-7424837 CACAAGGCCCTGCCTGCTTGTGG + Intergenic
1169653256 20:7893376-7893398 CAAAACCCCATTCCTGCCTGGGG + Intronic
1169811497 20:9613355-9613377 CCCATGGACAGTTCTGCCTGTGG - Intronic
1172152295 20:32798967-32798989 CCCTAGGTCATTCCTGTCTGGGG + Intronic
1173639360 20:44589293-44589315 CACCAGTACACTCCAGCCTGGGG + Intronic
1173916291 20:46710677-46710699 CACAAACTCATTCCTGCCTGAGG - Intronic
1174083812 20:47990381-47990403 CACAAGCACCATCCTGCCTCAGG - Intergenic
1175195669 20:57241683-57241705 GCCAAGGAGATGCCTGCCTGTGG - Intronic
1175568229 20:59997953-59997975 CACAGGCACATACCTGCCAGAGG - Intronic
1178635366 21:34297886-34297908 CAGAAGTACATTGCTCCCTGGGG - Intergenic
1179224439 21:39441262-39441284 CACAACTACATTCCAGCCTGAGG + Intronic
1179475136 21:41638257-41638279 CACAAGCACAGTCCTGCTTTAGG - Intergenic
1180491556 22:15853873-15853895 CGCCAGGACACTCCTCCCTGAGG + Intergenic
1180979778 22:19873064-19873086 CACAGGGGCAGCCCTGCCTGAGG + Intergenic
1181732826 22:24859892-24859914 CACAAGGAAGTTCCTCCCCGGGG + Intronic
1182508415 22:30802213-30802235 CCCAGGGACTTTCCTGGCTGGGG + Intronic
1183211091 22:36451899-36451921 CACAAGGCCCTTCCGTCCTGCGG + Intergenic
1183240037 22:36650841-36650863 CACAGGCACACTCCTGCCTCGGG + Intronic
1183310164 22:37105284-37105306 AGCTAGGACATTCCTGCATGTGG + Intronic
1183513981 22:38252545-38252567 CTCCAGGTCACTCCTGCCTGTGG - Intronic
950063557 3:10092643-10092665 GACAAGGACATTCTAGGCTGGGG - Intronic
950112142 3:10426068-10426090 CACAAGTGCTTTCCTGCCTTAGG + Intronic
950469359 3:13174909-13174931 CACAAGGCCACTCCTGCCGCAGG + Intergenic
952192047 3:31034166-31034188 CACTAGGACATTTCTTCCTTAGG - Intergenic
952984008 3:38761367-38761389 CACAATGACCTTCAGGCCTGCGG + Exonic
954999063 3:54909945-54909967 TACATGGACTTTCTTGCCTGAGG + Intronic
955766999 3:62355285-62355307 GCCAAGCACATTCCTGCCTCGGG - Intergenic
956536422 3:70281957-70281979 CACAAGGCCAGTCCTGGCTTAGG + Intergenic
956560776 3:70571714-70571736 CACCATGACACTCCAGCCTGGGG + Intergenic
957974874 3:87430244-87430266 CACAAGCACATCACTGCCTCAGG + Intergenic
958851151 3:99327164-99327186 CATAGGGATATTCCTACCTGCGG - Intergenic
959061830 3:101623200-101623222 AACAAGGAATTTCCTGCCTTCGG - Intergenic
959114579 3:102161666-102161688 AACAAGGACATTGAGGCCTGGGG - Intronic
959510643 3:107207825-107207847 CACAGGCACATCCCAGCCTGTGG + Intergenic
961064352 3:123861938-123861960 CATGAGGATACTCCTGCCTGCGG - Intronic
961824497 3:129592041-129592063 CACAAGCTCGTTCCTGCCTCAGG + Intronic
962708261 3:138065163-138065185 CAGAAAGTCATTCTTGCCTGTGG - Intronic
962932798 3:140053127-140053149 CACAAGCATCCTCCTGCCTGAGG + Intronic
962964229 3:140338713-140338735 CACAAGGCTTTTCCTGCGTGAGG + Intronic
967230017 3:187328915-187328937 CACAGGTACATCCCTGCCTCTGG - Intergenic
967381981 3:188869089-188869111 AACAAGGAGATTCCTGGCAGAGG + Intronic
969503782 4:7570997-7571019 TCCAAGGAAATCCCTGCCTGTGG + Intronic
970020904 4:11567604-11567626 CACAAATACATTCCTGCCCTGGG - Intergenic
970757456 4:19443477-19443499 CACCTGAACATTCCTCCCTGGGG + Intergenic
971768122 4:30860558-30860580 AACAAGGACATACCTTTCTGAGG + Intronic
977240632 4:94564406-94564428 CACTGGTACATTCCTGCCTCAGG + Intronic
977303794 4:95298489-95298511 CACCAGCACACTCCTGCCTCAGG + Intronic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
981181637 4:141752560-141752582 CACAAGGACAAAACTGTCTGAGG - Intergenic
982457110 4:155623451-155623473 CACAAGCACTTGGCTGCCTGTGG - Intergenic
984740672 4:183158460-183158482 CACATGGTCTTTCCTGTCTGTGG + Intronic
985368807 4:189262984-189263006 GAAAAGGAGATCCCTGCCTGGGG + Intergenic
985544692 5:503679-503701 TACAGGGAAAATCCTGCCTGTGG + Intronic
985784188 5:1885636-1885658 CACAGGGTCAATCCAGCCTGTGG + Intronic
986628387 5:9745018-9745040 CACAATGACATTTCTGCTTGAGG + Intergenic
988526403 5:31991019-31991041 CACTCTGTCATTCCTGCCTGAGG - Intronic
988683276 5:33503440-33503462 CTCCAGGACATTCCTCCCTGAGG - Intergenic
990846713 5:60148698-60148720 CACAAGGACATAGCTGCCATTGG + Intronic
991994139 5:72370623-72370645 CACCAGCACATTCCTGCTTCAGG + Intergenic
992166042 5:74052850-74052872 AATAAGAACATTCCTGTCTGAGG + Intergenic
993151221 5:84164859-84164881 CAGAGGGACTTTCCTGCCTGAGG + Intronic
993897249 5:93550676-93550698 CACAATGTAATTCCTGCCTTCGG - Intergenic
994697899 5:103095880-103095902 CACAACTACACTCCAGCCTGGGG + Intronic
997009084 5:129855807-129855829 CACAAGAACTTTCTTGCCTATGG + Intergenic
997253164 5:132406982-132407004 CACCATCACATTCCAGCCTGGGG + Intergenic
999509588 5:152234887-152234909 CACAAGGTCATTGCTGCCACAGG - Intergenic
1000150985 5:158500841-158500863 CACATGGACATGCATGCTTGTGG + Intergenic
1001553057 5:172618120-172618142 CATAAGGAGAGTCCTGCCTTGGG + Intergenic
1001596009 5:172899160-172899182 CACCAGGTCATCCCTGCCTGAGG - Intronic
1001870413 5:175149358-175149380 CTCAAGGACTTTGCAGCCTGTGG - Intergenic
1001936200 5:175707747-175707769 CACAAGCACATGCCAGGCTGAGG - Intergenic
1002795304 6:466807-466829 CACAGGGACATGCCTCCCTGTGG + Intergenic
1005559767 6:27026537-27026559 CCCAAGCTCATTCCTGCCTCAGG + Intergenic
1008227433 6:48937244-48937266 CACAATGGCATTGCTGCCAGGGG + Intergenic
1008462470 6:51791357-51791379 CACAAGGACAGTTCTGTCTGTGG + Exonic
1011284878 6:85712598-85712620 CACCACAACATTCCAGCCTGGGG + Intergenic
1020390790 7:7655875-7655897 CACCATGGCATTCCAGCCTGGGG - Intronic
1023366451 7:39469029-39469051 CACAGGCTCATTCCTGTCTGTGG + Intronic
1023778874 7:43637130-43637152 CACAGGGACACTACTGCCTCTGG + Intronic
1024524403 7:50336310-50336332 CACCAGCACATGCGTGCCTGTGG - Intronic
1024997176 7:55280540-55280562 CCCAAGGACTTTCCTACCTGTGG - Intergenic
1026167287 7:67921794-67921816 CACAAGGAGCTCACTGCCTGGGG + Intergenic
1030128592 7:106178262-106178284 CAGAGGGGCATTCCTGGCTGTGG - Intergenic
1030701754 7:112648076-112648098 CACAAAGGCATTCTTGTCTGTGG - Intergenic
1032430507 7:131857406-131857428 GACAAGCTCATTCCTGCCTTGGG - Intergenic
1032639822 7:133753642-133753664 AGGAAGCACATTCCTGCCTGAGG + Intronic
1033658845 7:143390379-143390401 CACTAGGACCTTCCTGCAAGAGG - Intronic
1034787425 7:153937803-153937825 CACCAGGAGATTCCTGCCCAGGG + Intronic
1036016967 8:4796098-4796120 CACAAGGAGTTTACTGTCTGTGG + Intronic
1036021018 8:4846417-4846439 CTCAAGGACAAGCCTGGCTGGGG - Intronic
1036412512 8:8515411-8515433 CACATAGCCAGTCCTGCCTGAGG - Intergenic
1036771276 8:11579792-11579814 CACAGGGGCAGTCCAGCCTGTGG + Intergenic
1038410014 8:27350932-27350954 CACCAGTGCATTCCAGCCTGGGG + Intronic
1045515902 8:102861267-102861289 CACCAGGGCACTCCAGCCTGGGG - Intronic
1047825761 8:128572955-128572977 CACAAGCACTCTCCTGCCTCAGG - Intergenic
1048794476 8:138137395-138137417 CACAAGGACATTCTGTCCTGAGG + Intronic
1049386488 8:142345419-142345441 CACAAGGACAGTCGGGCTTGAGG + Intronic
1051681358 9:19611196-19611218 CCCAAGCACACTCCTGCCTCAGG - Intronic
1055489793 9:76793134-76793156 CAGAAGGAGCTTCCTGACTGTGG + Intronic
1057000747 9:91506673-91506695 CACAGGGACATTACTGCCATAGG - Intergenic
1057137865 9:92706721-92706743 CACAAGCACATGGCTGCCTCAGG - Intergenic
1057494896 9:95553223-95553245 GACAAGGACATTCCCATCTGCGG - Intergenic
1057959519 9:99440882-99440904 CACATTGATATTCTTGCCTGTGG + Intergenic
1057981183 9:99665426-99665448 CCCAAGTACTTTCCTGCCTCGGG - Intergenic
1060147140 9:121262769-121262791 GACAAACACATTCCTGCCTGGGG + Intronic
1060685161 9:125603583-125603605 CACAAGGAAAATACTGCCAGGGG - Intronic
1061387171 9:130297243-130297265 CCCCAGGACATTCCTTCCTTTGG - Intronic
1185848285 X:3461129-3461151 CTAAAGTACTTTCCTGCCTGTGG + Intergenic
1186351281 X:8742246-8742268 CACACGCACAATCCTGCCTCAGG + Intergenic
1189848955 X:45160247-45160269 CACCATTACATTCCAGCCTGGGG - Intronic
1195045492 X:101051419-101051441 GACAAGGACCTGACTGCCTGTGG - Exonic
1195146179 X:102019224-102019246 CACAGGGACAGGGCTGCCTGGGG + Intergenic
1196109356 X:111929562-111929584 GTCAGTGACATTCCTGCCTGTGG + Intronic
1197269551 X:124410880-124410902 CACATGGACTTTCCAGCTTGGGG + Intronic
1198428158 X:136540364-136540386 GCCAAGGACAATCCTGCCTCAGG + Intronic