ID: 1152640782

View in Genome Browser
Species Human (GRCh38)
Location 17:81448360-81448382
Sequence CCGCCCACCCAGGGGCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152640774_1152640782 6 Left 1152640774 17:81448331-81448353 CCTATGGGACTGGGAGCTCCTGG 0: 1
1: 0
2: 0
3: 37
4: 327
Right 1152640782 17:81448360-81448382 CCGCCCACCCAGGGGCCCCAAGG 0: 1
1: 0
2: 4
3: 40
4: 401
1152640770_1152640782 21 Left 1152640770 17:81448316-81448338 CCTGCTGCAGGGAGGCCTATGGG 0: 1
1: 0
2: 3
3: 37
4: 260
Right 1152640782 17:81448360-81448382 CCGCCCACCCAGGGGCCCCAAGG 0: 1
1: 0
2: 4
3: 40
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152640782 Original CRISPR CCGCCCACCCAGGGGCCCCA AGG Intronic