ID: 1152642834

View in Genome Browser
Species Human (GRCh38)
Location 17:81456352-81456374
Sequence TTTCAGCTGGGCCACCCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152642834_1152642843 9 Left 1152642834 17:81456352-81456374 CCCACAGGGTGGCCCAGCTGAAA 0: 1
1: 0
2: 0
3: 22
4: 166
Right 1152642843 17:81456384-81456406 AAGAGCAAAGGGCTGCCCACAGG 0: 1
1: 0
2: 0
3: 22
4: 184
1152642834_1152642840 -2 Left 1152642834 17:81456352-81456374 CCCACAGGGTGGCCCAGCTGAAA 0: 1
1: 0
2: 0
3: 22
4: 166
Right 1152642840 17:81456373-81456395 AACCCAAGGTCAAGAGCAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 211
1152642834_1152642839 -3 Left 1152642834 17:81456352-81456374 CCCACAGGGTGGCCCAGCTGAAA 0: 1
1: 0
2: 0
3: 22
4: 166
Right 1152642839 17:81456372-81456394 AAACCCAAGGTCAAGAGCAAAGG 0: 1
1: 0
2: 2
3: 21
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152642834 Original CRISPR TTTCAGCTGGGCCACCCTGT GGG (reversed) Exonic
900791065 1:4681310-4681332 TGTCAACTGGGCCACACTGTTGG + Intronic
901081277 1:6585657-6585679 GGTCAGCTGGGCCTCCCTGTCGG + Intronic
904358663 1:29958523-29958545 TGTCTGCTGGTCCACCATGTTGG - Intergenic
906928176 1:50141527-50141549 TTTCAGCTCTGCCAAGCTGTGGG - Intronic
909227609 1:73045196-73045218 TCTGAGCTGAGCCACCCTGTGGG - Intergenic
909830194 1:80179064-80179086 TTTCAGGTGTGCCACCCTCCTGG - Intergenic
916053979 1:161054983-161055005 CTTCAGTGGCGCCACCCTGTGGG + Intronic
916594721 1:166233202-166233224 TCTCAGCTGGCTCAGCCTGTGGG - Intergenic
919504120 1:198375960-198375982 TTTCAGCTGGGGCCTGCTGTGGG - Intergenic
922425157 1:225485485-225485507 TGTCAGCTGGGCCACCTGGGTGG + Intergenic
1062893031 10:1079711-1079733 TTTCAGTAGAGACACCCTGTTGG + Intronic
1062961328 10:1575694-1575716 GTTCAGCTGGGGGACTCTGTGGG + Intronic
1064064592 10:12170455-12170477 TGTCATCTGGGCCATTCTGTAGG + Intronic
1068499161 10:57821196-57821218 TTTCAGTTGGGACTCCTTGTTGG - Intergenic
1068949118 10:62759899-62759921 TTCCAGCCAGGCCTCCCTGTTGG - Intergenic
1068984025 10:63090499-63090521 TCTCAGCTGGGGGATCCTGTGGG - Intergenic
1071716448 10:88101131-88101153 TTTTAGTTGGGCCACTATGTTGG + Intergenic
1073622292 10:105061943-105061965 TCTCAGCTGGGTCACTCTCTGGG - Intronic
1074834220 10:117273825-117273847 TTTCATTTGGTCCACCATGTTGG + Intronic
1076728366 10:132424297-132424319 CTTGAGCTGGGCCACCCTGGAGG + Intergenic
1077177522 11:1197462-1197484 TTGCAGGTGGGCCACACCGTCGG + Intronic
1080394132 11:31874537-31874559 TTTCAGCTGGGTCCTCTTGTTGG - Intronic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1091991214 12:4957474-4957496 GCTCAGCTGGGCCACCTTGCCGG + Intergenic
1092253766 12:6915486-6915508 TTGCAGCTTGGCCAGCCGGTGGG - Exonic
1093577836 12:20754804-20754826 TTTGAGCTGGGCCTTCTTGTTGG - Intergenic
1094865900 12:34529704-34529726 TTTCAGCTGGTCCCTCCTTTTGG - Intergenic
1096140715 12:49240527-49240549 TCACAGCAGGGGCACCCTGTGGG - Intronic
1098292986 12:68976374-68976396 TTTCAGCTGTGCCACCTAGGAGG - Intergenic
1100028538 12:90158800-90158822 TTCCACCTGGGCCACCCAGAAGG + Intergenic
1101293945 12:103401630-103401652 TGTGAGCAGTGCCACCCTGTGGG - Exonic
1101473627 12:105022661-105022683 TTTCAGCTGTGCCAAACTCTGGG + Exonic
1101525481 12:105524559-105524581 TTTTACCTGGGCCACCATGGAGG - Intergenic
1106455899 13:29926516-29926538 TTTCTGCTGAGCCAGCCAGTGGG - Intergenic
1110260045 13:73474840-73474862 TGTCCCCTAGGCCACCCTGTTGG + Intergenic
1110320826 13:74158272-74158294 TTCCTGCCTGGCCACCCTGTGGG + Intergenic
1111598721 13:90444643-90444665 TGTCTGCTGGTCCACCCTGTAGG - Intergenic
1111653624 13:91125392-91125414 TTTCAGCTTTGTCACCCTGTTGG - Intergenic
1112301363 13:98233524-98233546 TTTCAGCTGGGGAACCCTCCTGG - Intronic
1112328024 13:98456666-98456688 GTTCATCTGTGCCAGCCTGTAGG - Intronic
1113931092 13:113969340-113969362 TTTCAGCTTTGCCACCCTAAAGG + Intergenic
1115063655 14:29226700-29226722 TTTGATCTTGGCCACCCTGAAGG + Intergenic
1116023275 14:39486599-39486621 TGTCAGAATGGCCACCCTGTAGG - Intergenic
1116635135 14:47384811-47384833 GTTCATCTGGGCCACCCTACTGG - Intronic
1117829284 14:59733790-59733812 TCTCAGCTGGTCTAGCCTGTGGG + Intronic
1117834297 14:59786176-59786198 TTGCAGCTGGACCACCTTGGTGG - Intronic
1118977518 14:70690503-70690525 TGTCAGGTTGGCCACCCTGCAGG - Intergenic
1121175182 14:91885536-91885558 CTGGAGCTGGGCCACCCTCTGGG + Intronic
1121535112 14:94685836-94685858 ATCCAGCTGGGCCCCCCTGTAGG - Intergenic
1122310250 14:100789778-100789800 TTTCAGCTTTGCCTCCATGTGGG - Intergenic
1125854917 15:42939464-42939486 CTTCACCTGGGCCACCTTCTTGG + Intergenic
1127633136 15:60844680-60844702 TTTAAGCTGGGCCTCGCTGAGGG - Intronic
1128894161 15:71357430-71357452 TTTCAGCAAGTCCACCCAGTGGG + Intronic
1130228766 15:82080625-82080647 ATTCATCAGGGCCATCCTGTAGG + Intergenic
1131413651 15:92232528-92232550 TCTCAGCTGTGCCACCTTGTAGG - Intergenic
1131530394 15:93186162-93186184 TGTCATCTGGCCCACCCTTTGGG + Intergenic
1132602525 16:780046-780068 TGCCAGCGGGGCCAACCTGTGGG - Exonic
1132904150 16:2273617-2273639 TTTCAGTTGAGCCACGCCGTTGG + Intergenic
1141348753 16:83273625-83273647 TTTTAAATGGGCCTCCCTGTTGG - Intronic
1143462147 17:7110524-7110546 GCACAGCTGGGCTACCCTGTGGG - Intronic
1144723586 17:17489163-17489185 TTGCAGAGGGGCCTCCCTGTGGG + Intronic
1148632587 17:49122889-49122911 TTTCGACTATGCCACCCTGTGGG - Intergenic
1150291209 17:63983440-63983462 TCTCAGCTGGGGCAGGCTGTGGG + Intergenic
1151455950 17:74225907-74225929 CTCCAGCTGGGCCTCCCTGATGG - Intronic
1152642834 17:81456352-81456374 TTTCAGCTGGGCCACCCTGTGGG - Exonic
1156136988 18:34053405-34053427 TCTCAGCTGGGACAACCAGTAGG + Intronic
1156723105 18:40094493-40094515 TTTGAACTGGGCCATTCTGTTGG + Intergenic
1157685393 18:49639019-49639041 TCTCAGCTGGGCCCCCCAGTGGG + Intergenic
1158327449 18:56326707-56326729 TTTCTGCTGGGCCACCTTCGTGG - Intergenic
1158963975 18:62607779-62607801 TTGGAACTGGGCCACACTGTAGG + Intergenic
1160123167 18:76148112-76148134 GCTCTCCTGGGCCACCCTGTGGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161951909 19:7472143-7472165 TTTCTGCTCGGCCACGCGGTGGG + Exonic
1163456099 19:17406536-17406558 TTTCAGCAGGGCCAGACAGTAGG + Intronic
1167220533 19:48195845-48195867 TTCCAGCTGGGCCACCCTCCAGG - Exonic
926685494 2:15694820-15694842 CTTCAGCTGGGCCCCACTATTGG - Intronic
926987400 2:18639649-18639671 TCTCAGCTGGTCCAGCCTGTGGG - Intergenic
927138235 2:20112874-20112896 CTTCAGCTGGGCCTCCGTGGTGG - Intergenic
929401106 2:41582551-41582573 TCTCAGCTGGTCCAGCCTGTGGG + Intergenic
933985050 2:87583976-87583998 TTCCAGCTGGTCCACCCGGCGGG - Intergenic
936308793 2:111366834-111366856 TTCCAGCTGGTCCACCCGGCGGG + Intergenic
937705091 2:124911388-124911410 TTCCAGGTGGGCCACACTGTAGG + Intronic
940124638 2:150310061-150310083 TCTCAGCAGGTCCAGCCTGTGGG + Intergenic
943898019 2:193392616-193392638 GTTAAGCTGGGGCACACTGTGGG + Intergenic
946414788 2:219534542-219534564 TTTCTGCTGGGGCCTCCTGTTGG + Intronic
946494242 2:220179517-220179539 ATTCAGCTGAGCCAACCAGTTGG + Intergenic
946971211 2:225093747-225093769 TTGCAGCTGAGGCACCCTGCAGG + Intergenic
947606733 2:231490979-231491001 TTTCAGCTGCGTTCCCCTGTAGG - Intergenic
948330325 2:237159640-237159662 TTTCTGTGGGGCCACCCTGAAGG + Intergenic
948685093 2:239665337-239665359 CTTCACAGGGGCCACCCTGTGGG - Intergenic
948685121 2:239665415-239665437 CTTCACAGGGGCCACCCTGTGGG - Intergenic
948685149 2:239665493-239665515 CTTCACAGGGGCCACCCTGTGGG - Intergenic
948685177 2:239665571-239665593 CTTCACAGGGGCCACCCTGTGGG - Intergenic
948685205 2:239665649-239665671 CTTCACAGGGGCCACCCTGTGGG - Intergenic
948913628 2:241018999-241019021 TCTCCGCTTGGCCACCCTTTGGG - Intronic
1168964492 20:1891058-1891080 CTTGACCAGGGCCACCCTGTGGG - Intergenic
1170019190 20:11816895-11816917 TTTCAGCTAGGATACTCTGTTGG + Intergenic
1170634647 20:18093636-18093658 GTTCAGCTGGGGCTCCCTGCAGG + Intergenic
1171235754 20:23523280-23523302 TGTCAGAATGGCCACCCTGTAGG - Intergenic
1171293178 20:23994198-23994220 GATCAGCTGGGTCACCCTGGTGG + Intergenic
1172598857 20:36169664-36169686 TTTGAGCTGAGTCACCATGTGGG - Intronic
1175375228 20:58519505-58519527 ATGAAGCTGTGCCACCCTGTAGG + Intergenic
1177276524 21:18919205-18919227 TGTCAGGAGGGCCACCTTGTAGG + Intergenic
1177781796 21:25629959-25629981 TTTAAGCAGGGGCACTCTGTGGG + Intergenic
1183241444 22:36660694-36660716 TTTCAACTGGGGCACTTTGTGGG - Intronic
1183359171 22:37374598-37374620 GTTCACCTCGGCCACCCTGGTGG - Exonic
1183869227 22:40728732-40728754 CTTCAGGTGATCCACCCTGTTGG + Intergenic
1184217128 22:43075237-43075259 TTTCAGCACAGCAACCCTGTGGG - Intronic
949250040 3:1972868-1972890 ATTCAGCTGCGCTATCCTGTAGG + Intergenic
951420293 3:22475857-22475879 TCTCAGCTGAGTCACCCTCTGGG + Intergenic
953936261 3:47046003-47046025 ATTCACCTGAGCCACCCTGAGGG - Intronic
962686957 3:137857158-137857180 TGTGAGCTGGGCCAGACTGTGGG + Intergenic
963285470 3:143430746-143430768 TTTCAGCTGAGCCACCTTCCAGG + Intronic
967871291 3:194231971-194231993 TTGCAGCCGGGACACCCTCTAGG - Intergenic
972689098 4:41379314-41379336 TGTCATCTAGGCCTCCCTGTGGG + Intronic
972995027 4:44869619-44869641 TTCAACCTGGGCCACCCTGTGGG - Intergenic
973581067 4:52344686-52344708 TGTCAGAATGGCCACCCTGTAGG + Intergenic
977084390 4:92575774-92575796 TCTCAGCTGGTCCAGACTGTGGG - Intronic
979096973 4:116563232-116563254 TCTCAGCCGGTCCAGCCTGTGGG + Intergenic
979595150 4:122526295-122526317 TTTCATCTGTGCCACACTGGAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980402843 4:132315451-132315473 TTTCAGAGTGGCCACCCTGTAGG - Intergenic
980510131 4:133774214-133774236 TTTCAGCTCTGCCTCCCTCTAGG + Intergenic
983840316 4:172449920-172449942 TTTCAGCTGCCTCCCCCTGTTGG + Intronic
985629356 5:1006758-1006780 CTCCAGCTTGGGCACCCTGTAGG + Intergenic
987168940 5:15232610-15232632 TTTTAAATGGGCCACTCTGTGGG - Intergenic
987415979 5:17662782-17662804 TCTCAGCTGGTCCAGCCTGTGGG - Intergenic
987906851 5:24088576-24088598 TCTCAGCTGGTCCAGCCTGTAGG + Intronic
993942327 5:94074670-94074692 TTTCATCTGGACCTCCCTGCTGG + Exonic
995988897 5:118211586-118211608 TTTCAGCTGTGGTACCCTCTGGG - Intergenic
996778593 5:127159681-127159703 TCTCAGCTTGTCCAGCCTGTGGG - Intergenic
997300198 5:132798083-132798105 TTTGAGCTGGGGAACCCTGGGGG + Intronic
997638829 5:135435264-135435286 TCTCAGCTGGGCCATCGGGTGGG + Intergenic
999666215 5:153916470-153916492 TCTCAGCTAGTCCAGCCTGTGGG - Intergenic
1000255499 5:159534627-159534649 TTGAAGCTGGGCCACACAGTGGG - Intergenic
1002160207 5:177310525-177310547 CTTCAACTGGGCCCTCCTGTGGG + Exonic
1002405611 5:179027823-179027845 TCTCAGCAGGAACACCCTGTGGG - Intronic
1003969177 6:11281652-11281674 TTTGGGCTCTGCCACCCTGTTGG - Intronic
1003975892 6:11344292-11344314 ATTCACCTGGTCCACTCTGTTGG + Intronic
1004595273 6:17093787-17093809 GCTCAGCTGGGCCCTCCTGTTGG - Intergenic
1005662817 6:28016828-28016850 TTTCAGACTGGCCTCCCTGTAGG + Intergenic
1006055116 6:31378456-31378478 TTTCAGGTGGGGAATCCTGTAGG + Intergenic
1007230376 6:40343926-40343948 GTCCAGCTGGGTCAGCCTGTGGG - Intergenic
1008432545 6:51436261-51436283 TTTCAGCGAGGCCACCCCTTGGG + Intergenic
1009289720 6:61868036-61868058 TCTCAGCTGGTCCAGCCTGCAGG - Intronic
1009534262 6:64860721-64860743 TTTCAGCTCTGCCACTCAGTGGG + Intronic
1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG + Intronic
1011113651 6:83866101-83866123 TTTCAGCTGGCCCAGGCTGCAGG + Intronic
1014393538 6:120894876-120894898 AGTCAGCTGGTCCAGCCTGTGGG - Intergenic
1016423747 6:143912823-143912845 TCTCAGCTTGTCCAGCCTGTGGG - Intronic
1016562746 6:145415266-145415288 TTTCACCTGAGCCATACTGTTGG + Intergenic
1016661436 6:146585593-146585615 TGTCAGCATGGCCACCCTGAAGG + Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017679931 6:156853448-156853470 CTTAACCTGGGTCACCCTGTAGG + Intronic
1021866496 7:24963376-24963398 TGTCAGCAGTGCCACTCTGTGGG + Intronic
1022076213 7:26973722-26973744 ATTCAGCTGTTCCAGCCTGTGGG - Intronic
1024994570 7:55261925-55261947 TTTTGGGTGGGCCACCTTGTGGG - Intergenic
1028224984 7:88239734-88239756 TTTTAGCTGGTCCACTTTGTGGG + Intergenic
1030367637 7:108663537-108663559 TCTCTGTTGGGCCACCCTGATGG + Intergenic
1033977138 7:147116405-147116427 TCTCAGCTAGTCCAGCCTGTGGG - Intronic
1034211277 7:149365304-149365326 CTCCAGCTGGGCCAACCTGCTGG - Intergenic
1034596212 7:152195440-152195462 TTTCAGCTGAAACAACCTGTAGG - Intronic
1034745878 7:153523725-153523747 TTTCTCCTGGGCCTCCCTGCTGG + Intergenic
1038689307 8:29746623-29746645 TTTCCCCTGGGCCACCCCCTTGG - Intergenic
1040400670 8:47046216-47046238 TCTCAGCTGGTCCAACCTGTGGG + Intergenic
1043154028 8:76755019-76755041 CCACATCTGGGCCACCCTGTGGG + Intronic
1044450938 8:92335462-92335484 TCTCAGCTGGTCCAGCCTATGGG - Intergenic
1045694322 8:104790931-104790953 TTTCAGGTGACACACCCTGTGGG - Intronic
1049850128 8:144826525-144826547 TTTCACCTGGGCCTCCCTGGGGG + Intergenic
1051668177 9:19484731-19484753 TCTCAGCAGGGCCACTCTGGAGG - Intergenic
1052495724 9:29221017-29221039 TTTCACATGGCCCACCCTTTGGG - Intergenic
1053146822 9:35717703-35717725 TGTCCGCTGGGCCACACTCTTGG + Exonic
1053275738 9:36782005-36782027 TTTAATCTGAGCAACCCTGTTGG + Intergenic
1056658273 9:88526461-88526483 TCTCAGTTGGGCCACCATGAGGG - Intergenic
1058620591 9:106878904-106878926 TTTCATCTTAGCAACCCTGTTGG + Intronic
1058671847 9:107366776-107366798 TCTCAGCAGTGCCACCCTGGGGG + Intergenic
1061519148 9:131107363-131107385 TTTTACTTGGGCCACTCTGTAGG - Intronic
1186368976 X:8927220-8927242 TTTCAGTTGGGCCTCCCTTTGGG + Intergenic
1186437104 X:9552090-9552112 CCTCAGATGGGCCACCCTTTGGG + Intronic
1189581665 X:42413675-42413697 TCTCAGCTGGTCCAGCCTGTGGG - Intergenic
1189798917 X:44674065-44674087 TTTCAGCAGGGCCATGCTGAAGG + Intergenic
1190792672 X:53714689-53714711 TTTCACCAGGGACACCCTGCAGG + Intergenic
1191900688 X:66038240-66038262 TCTCAGCTGGACAACTCTGTGGG - Intronic
1191930262 X:66364812-66364834 TTTCAGCCAGTCCAGCCTGTGGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192718580 X:73668925-73668947 TATCAGCTGGTCTAGCCTGTGGG - Intronic
1195708975 X:107759201-107759223 GTTCAGCTGGGACCCCCTCTTGG + Intronic
1199589235 X:149451093-149451115 TCTCAGCTGCTCCAACCTGTGGG - Intergenic
1200006384 X:153087944-153087966 TTTCAGAAGGGTCACCCTGGTGG + Intergenic