ID: 1152642889

View in Genome Browser
Species Human (GRCh38)
Location 17:81456553-81456575
Sequence GGACGCAGCCACGGAGGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152642889_1152642900 8 Left 1152642889 17:81456553-81456575 CCCAGCCCTCCGTGGCTGCGTCC 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1152642900 17:81456584-81456606 AGGCAAGTTGCTGGCGTGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
1152642889_1152642899 -1 Left 1152642889 17:81456553-81456575 CCCAGCCCTCCGTGGCTGCGTCC 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1152642899 17:81456575-81456597 CCAGGAGGCAGGCAAGTTGCTGG 0: 1
1: 1
2: 3
3: 39
4: 541
1152642889_1152642901 19 Left 1152642889 17:81456553-81456575 CCCAGCCCTCCGTGGCTGCGTCC 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1152642901 17:81456595-81456617 TGGCGTGAGTGGCCACTGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1152642889_1152642902 27 Left 1152642889 17:81456553-81456575 CCCAGCCCTCCGTGGCTGCGTCC 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1152642902 17:81456603-81456625 GTGGCCACTGCCAGGAGCCCCGG 0: 1
1: 0
2: 4
3: 42
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152642889 Original CRISPR GGACGCAGCCACGGAGGGCT GGG (reversed) Exonic
900137151 1:1122442-1122464 GGAGGCAGCCCCGCCGGGCTGGG + Intergenic
900565901 1:3331728-3331750 GGACGCAGCCCAGGAGCCCTGGG - Intronic
900902661 1:5527437-5527459 GGAAGGAGCCACGGAGGGAACGG - Intergenic
901319462 1:8330657-8330679 GGACGCTGCCAGGGATGGCCAGG - Exonic
901456786 1:9367704-9367726 GGAGGCAGCCACGGAGGATGAGG - Exonic
902390160 1:16099066-16099088 GGGCGCACCCAGGGAGGGCATGG - Intergenic
902605307 1:17565851-17565873 GGAGGCAGCCAGGGAGGGAGGGG - Intronic
903455670 1:23484759-23484781 GTACGCAGCAAAGGAGGGGTGGG - Intergenic
903938600 1:26913503-26913525 CACCGCAGCCAGGGAGGGCTGGG + Exonic
904171071 1:28592502-28592524 GGACGCGGCCATGGAGGCCGAGG + Intronic
906239078 1:44230389-44230411 GAACCCAGCCAGGGAGGGGTTGG + Intronic
907752277 1:57273695-57273717 GGAAGCAGCCAGGGGCGGCTAGG - Intronic
909091307 1:71229214-71229236 GGAATCAGGAACGGAGGGCTGGG + Intergenic
911335049 1:96572777-96572799 GGAAGCAGCCTGGTAGGGCTGGG - Intergenic
915118916 1:153616492-153616514 GGAGGGAGCCACAGAGGGCTGGG + Intronic
917968732 1:180194232-180194254 GCACGTAGCCTCGGATGGCTGGG - Exonic
918807664 1:189070275-189070297 GGACGGAGACAGGGAGGGCAAGG + Intergenic
919729189 1:200902062-200902084 TGAGGCAGCCAGGGAGGTCTGGG - Intronic
919897081 1:202015649-202015671 GGACTGAGCCAAGGAGGCCTGGG + Exonic
920572008 1:207024561-207024583 GGAGGGAGTCAGGGAGGGCTGGG - Intronic
923107956 1:230868673-230868695 GGAGGGGGCCACGGAGGGCCGGG - Intronic
1062874028 10:931314-931336 GGACGCGGCCGCGGCGGGCAGGG - Intronic
1073414253 10:103368180-103368202 GGAGACAGCCACCGTGGGCTTGG - Exonic
1074722118 10:116272601-116272623 CGCCGCCGCCACCGAGGGCTCGG - Intronic
1074886568 10:117698725-117698747 GGACACAGCCACGGTTGGATTGG + Intergenic
1075693595 10:124418295-124418317 TGATGCAGCCTTGGAGGGCTGGG - Intronic
1076478613 10:130769425-130769447 GGAAGCAGCCAGGGGTGGCTGGG - Intergenic
1076649789 10:131979997-131980019 GGACGGGGCCACTGTGGGCTCGG - Intronic
1077035095 11:490617-490639 GGAGGAGGCCACGGAGGCCTGGG - Exonic
1077173318 11:1177968-1177990 GGCCACAGCCAAGGAGCGCTGGG - Intronic
1077578559 11:3402620-3402642 GGACCCAGACACGGAGCGGTCGG + Intergenic
1078495328 11:11811454-11811476 GGACTCACCCAGGGAGTGCTTGG + Intergenic
1078597611 11:12702009-12702031 GGAGCCAGCCAGAGAGGGCTGGG - Intronic
1079111641 11:17608299-17608321 GTAGGCAGCCCCCGAGGGCTTGG - Exonic
1079508482 11:21182640-21182662 GGAAGCAGCTACCTAGGGCTAGG + Intronic
1083637942 11:64130352-64130374 GAAAGCAGCCATGGAGGGGTAGG - Intronic
1084673574 11:70621662-70621684 GTAAGCAGCCACGCATGGCTGGG - Intronic
1085317723 11:75555485-75555507 GGACGCAGCCAGGGGAGGGTAGG - Intergenic
1086143458 11:83524532-83524554 GGAGGCAGCCCCAGAGGGCAGGG - Intronic
1089436970 11:118477157-118477179 GGAGGTAGCCAGGGAAGGCTGGG + Intronic
1090994910 11:131857324-131857346 GGACACAGCCATGGAAGGCAAGG - Intronic
1091554633 12:1563362-1563384 GGAGGCAGCCACGGAGGACACGG - Intronic
1091568003 12:1662252-1662274 GGCCGCGGCCACAGAGGGCTGGG - Intergenic
1092238625 12:6824518-6824540 GGGCCCGGCCCCGGAGGGCTCGG + Exonic
1096185619 12:49578677-49578699 AGAGGCAGCCAAGGAGGGATGGG + Intronic
1096749247 12:53748280-53748302 GGGCGCTGGCGCGGAGGGCTTGG - Intergenic
1096829698 12:54304564-54304586 GGAGGCAGCCACAGGGGGCAAGG + Intronic
1097189519 12:57212781-57212803 GGAGACAGGCAGGGAGGGCTTGG + Exonic
1102025874 12:109714161-109714183 GGATGCAGCCTCGGGGGCCTCGG - Intergenic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1108523224 13:51263174-51263196 GGACGGAGCCCCTGTGGGCTGGG - Intronic
1112196950 13:97235717-97235739 GGAAGGAGCCACAGAGGGTTCGG - Intronic
1113581064 13:111429459-111429481 GGGCGGAGCCACCGAGGGGTCGG - Intergenic
1117178331 14:53168023-53168045 GGACACTGCCAAGGAGAGCTAGG - Intergenic
1120392314 14:83924469-83924491 GGAAGCAGCCATGGTGGGCATGG - Intergenic
1120935454 14:89891784-89891806 GGACGCGGCCATGGAGGCCGAGG + Intronic
1122156008 14:99750851-99750873 GGAAGCATCCATGGAAGGCTGGG + Intronic
1122290351 14:100677549-100677571 GGAACCTGCCCCGGAGGGCTTGG + Intergenic
1123768985 15:23510189-23510211 GGAAGCACCCACGGAAGACTAGG - Intergenic
1129843565 15:78758112-78758134 AGCCGCAGCCACTCAGGGCTGGG - Intergenic
1132814339 16:1818641-1818663 GGCCGCAGCCATGAAGGGCCCGG + Intronic
1132981281 16:2739761-2739783 GGAGGCAGCCACAGAAGGCTGGG + Intergenic
1133174436 16:4003342-4003364 AGACGGAGCCATGGAGGACTGGG - Intronic
1133347164 16:5078769-5078791 GGACCCAGTCACGGAGCGGTCGG + Exonic
1133738443 16:8633116-8633138 GGACGCTGACACAGAGGGCCTGG + Intronic
1133930456 16:10228055-10228077 GGATGCAGACAAGCAGGGCTTGG - Intergenic
1135633594 16:24055428-24055450 TGCGGCAGCCACGGATGGCTGGG + Intronic
1135667587 16:24349082-24349104 TGATCCAGCCACGTAGGGCTGGG + Intronic
1136452213 16:30359751-30359773 GACCGCAGCCACGGGGGCCTGGG + Exonic
1139657180 16:68396134-68396156 GGTGACAGCCACGGAGGGGTTGG - Intronic
1139959735 16:70710694-70710716 GGACCAAGACACGGAGGCCTCGG + Intronic
1140481833 16:75266247-75266269 GGGCGCAGACCGGGAGGGCTCGG + Intronic
1140847685 16:78905899-78905921 GGAAGGAGCCAAGGATGGCTGGG - Intronic
1141463445 16:84191681-84191703 GGGCAGAGCCACGGAGGGCTGGG + Intronic
1141832984 16:86520010-86520032 GGAGGCAGCCAGGGGAGGCTGGG + Intergenic
1142709753 17:1716479-1716501 GGTCGCTGACGCGGAGGGCTGGG - Intergenic
1142989879 17:3723552-3723574 GGACGAAGCTAGGGAGGGCCTGG + Intronic
1143133215 17:4694204-4694226 GGAGGCAGCCAGGGAGGGCTTGG + Intronic
1144828386 17:18119133-18119155 GGCCGTAGCCACGGCGGCCTGGG - Exonic
1145066085 17:19762288-19762310 AGACGCAGGCAGGGAGAGCTGGG - Intergenic
1147612959 17:41812294-41812316 GGGCGCAGCGACGGAAGGCCCGG - Intronic
1147999285 17:44378436-44378458 GGACGCAGCCAACGAGGGCGAGG - Exonic
1148460576 17:47837056-47837078 GGCCTCAGCCACAGAGGCCTTGG - Exonic
1150626980 17:66848178-66848200 GCAACCAGTCACGGAGGGCTGGG - Intronic
1151396742 17:73827723-73827745 GGACGCAGGCACGAGGGCCTTGG + Intergenic
1152112603 17:78365578-78365600 GGCTGCAGCCGAGGAGGGCTGGG - Intergenic
1152642889 17:81456553-81456575 GGACGCAGCCACGGAGGGCTGGG - Exonic
1160174291 18:76580114-76580136 GGACACAGCCAGCTAGGGCTGGG + Intergenic
1160789625 19:917501-917523 GGACGTAGCCACGGTGTGCATGG - Exonic
1160818947 19:1049228-1049250 GGACTCAGCCATGGAGGTCATGG - Intronic
1161286484 19:3471113-3471135 GGTGGGAGCCATGGAGGGCTGGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162187973 19:8922062-8922084 AGATGCAGCCACAGAGGGCCTGG - Intronic
1162805453 19:13135899-13135921 TCCCGCAGCCACGGCGGGCTGGG - Exonic
1163415271 19:17182718-17182740 GAATGCAACCACGGATGGCTAGG + Intronic
1163634882 19:18433256-18433278 GGAAGCAGCCAGGGAGCGCACGG - Intronic
1165331324 19:35142581-35142603 CTACGCAGCCAGGGAGGGCCGGG - Intronic
1166382874 19:42364041-42364063 GGATGTGGCCAGGGAGGGCTAGG + Intronic
1167669443 19:50841349-50841371 GGACGCAGGTCAGGAGGGCTGGG + Intergenic
1168405483 19:56108255-56108277 GGAGGGAGCCAGGGAGTGCTGGG - Intronic
1168405524 19:56108359-56108381 GGAGGGAGCCAGGGAGTGCTGGG - Intronic
1168642599 19:58040109-58040131 GCACACAGCCCCGGGGGGCTTGG + Intronic
925019666 2:558441-558463 CGACGCGGCCATGGAGGGTTGGG - Intergenic
925153453 2:1633281-1633303 GGACGCAACCAGGGCCGGCTGGG + Exonic
928140592 2:28725559-28725581 GGACGCAGAATCTGAGGGCTGGG - Intergenic
928173058 2:29015810-29015832 GGAGGCAGCCAAGAAGGGCTGGG - Intronic
928197104 2:29223880-29223902 GGAGGGAGCCAGGGAAGGCTGGG + Intronic
931164584 2:59733132-59733154 GGAAGCCGCCTGGGAGGGCTTGG + Intergenic
932591566 2:73070930-73070952 GGACGCAGCCAGGGCGTGCGGGG - Intronic
935637737 2:105262571-105262593 TGACGCAGGCACGGAAGTCTGGG + Intergenic
943872057 2:193012116-193012138 GGGCACAGCCTGGGAGGGCTGGG - Intergenic
948150142 2:235738410-235738432 TCACTCAGCCAGGGAGGGCTCGG + Intronic
948392689 2:237624365-237624387 GGAGGCAGCCAGGGAAGCCTTGG - Intergenic
949026989 2:241770901-241770923 GGACCCAGCCACGGAGCTCCAGG - Intergenic
1170524564 20:17226010-17226032 GGGCGCAGCGACGGGGGGCAGGG - Intergenic
1170762779 20:19265444-19265466 GGATGAAGCCAGGAAGGGCTGGG + Intronic
1171773735 20:29347167-29347189 GCACGTAGCCTCGTAGGGCTTGG + Intergenic
1172125937 20:32625360-32625382 TGAGCCAGCCAGGGAGGGCTGGG + Intergenic
1175314741 20:58039536-58039558 GGACGGACCCAGGGAGGGCCTGG + Intergenic
1175524506 20:59624237-59624259 GGATGCAGCCACGGAGGGGTTGG - Intronic
1176199999 20:63855805-63855827 GGGCGCAGGGAGGGAGGGCTGGG + Intergenic
1179022831 21:37655815-37655837 AGACGAAGCCACGGAGGTCAGGG + Intronic
1179058432 21:37957068-37957090 TGAAGCACCCACGGAGGGCATGG + Intronic
1179451702 21:41472688-41472710 GCACGCAGCAAGAGAGGGCTGGG + Intronic
1179592510 21:42418493-42418515 GGACGAAGCCAGCGAGGGCTGGG + Exonic
1180707641 22:17818908-17818930 GGAGGCCGCCACGGGTGGCTGGG + Exonic
1180874714 22:19169760-19169782 GGCTGAAGCCGCGGAGGGCTCGG + Intergenic
1181369595 22:22405456-22405478 GGAGGCAGCCACAGAAGGCAAGG + Intergenic
1182144463 22:27988760-27988782 GGGAACAGCCACGGAGGGGTCGG - Intronic
1183302510 22:37065288-37065310 GGGCGTGGCCACTGAGGGCTGGG - Intergenic
1184034326 22:41911267-41911289 GGACACAGCCACCCAGGGGTGGG + Exonic
1184738052 22:46410602-46410624 AGAGGCGGCCACGGCGGGCTGGG + Intronic
1185206381 22:49541447-49541469 GTACGCACCCACGGAGCCCTCGG + Intronic
953983032 3:47422161-47422183 GGAAGCAGGCAGGGAGGGGTAGG + Intronic
954755781 3:52838961-52838983 AGAGGCAGCCACGGATGGTTAGG - Exonic
955051568 3:55415923-55415945 GGAAGGAGACAGGGAGGGCTGGG - Intergenic
957051567 3:75415933-75415955 GGACCCAGCCACAGAGCGGTTGG + Intergenic
961302910 3:125933662-125933684 GGACGCAGCCATGGAGCGGTCGG - Exonic
961381369 3:126498351-126498373 GGAGGCAGGGATGGAGGGCTGGG - Intronic
962345743 3:134618045-134618067 AGACGCAGCCACGGTGGGTCAGG - Intronic
966212761 3:177470048-177470070 GGACCCAGCCACAGAGGGGGTGG + Intergenic
966863845 3:184245419-184245441 GGCCCCAGCCTGGGAGGGCTGGG - Intronic
968994350 4:3936312-3936334 GGACCCAGCCACGGAGCGGTCGG + Intergenic
969300383 4:6293857-6293879 GGATGCAGCCTGGGCGGGCTGGG - Intronic
969819586 4:9709924-9709946 GGATCCAGCCACGGAGCGGTCGG - Intergenic
971392205 4:26196779-26196801 GGACACAGTCAGGAAGGGCTGGG - Intronic
972113277 4:35593244-35593266 GGACGCTGTCACGGAGGTCCTGG + Intergenic
981128585 4:141133264-141133286 GGCCGCCGCCACTGAGCGCTGGG + Intronic
983157998 4:164375931-164375953 TGACTCAGCCAGGGAGGTCTGGG - Intronic
985548539 5:521874-521896 GGAAGCACACAGGGAGGGCTGGG + Intronic
985772809 5:1823769-1823791 GGAGGCAGCCCCGCTGGGCTTGG - Intergenic
986206188 5:5627459-5627481 GGCTGCAGCCACGGAGGGGCAGG + Intergenic
986709086 5:10474656-10474678 GGACTCAGCCAAGCTGGGCTTGG + Intergenic
987761305 5:22165649-22165671 GGATGCAGCCCCGTAGGTCTTGG - Intronic
998156372 5:139789052-139789074 GCAGGGAGCCACGGAGGCCTGGG - Intergenic
999141601 5:149366031-149366053 GGACTCAGCCACAGAGTGCTGGG - Exonic
999302258 5:150498575-150498597 GGACAAAGCCAGGGAGGGCCTGG - Intronic
1001422189 5:171596424-171596446 GGAGGCATCCAGGGAGTGCTGGG + Intergenic
1001851353 5:174969738-174969760 GCACGCAGCCCGGGAGTGCTGGG - Intergenic
1002532729 5:179858363-179858385 GGACGCCGCCGCGGCGCGCTCGG + Intronic
1004485616 6:16063625-16063647 GGAGGAAGGCAAGGAGGGCTAGG + Intergenic
1005719789 6:28590026-28590048 GCCAGCAGCCCCGGAGGGCTCGG + Intronic
1006421029 6:33934298-33934320 GGACACAGCCAGAGAGGGCGTGG - Intergenic
1007085420 6:39141006-39141028 GGGCGGAGTCCCGGAGGGCTTGG + Intergenic
1007401004 6:41602279-41602301 GGCAGCCTCCACGGAGGGCTGGG - Exonic
1007733936 6:43968689-43968711 GGAGGCAGCCAAGGTGGGCAGGG + Intergenic
1011588901 6:88951989-88952011 GGAGGCAGACAGGGAGGGGTAGG + Intronic
1015480412 6:133702271-133702293 GGAGGCAGAGAGGGAGGGCTAGG - Intergenic
1015757490 6:136622215-136622237 GGACCCAGTCACTGAGGGCTGGG - Intronic
1017719898 6:157236678-157236700 GGACCCGGCCAGGGACGGCTCGG - Intergenic
1018723446 6:166591595-166591617 GGAGGCAGCCAAGGAGTGCCTGG + Intronic
1018744359 6:166750480-166750502 GGAAGCAGCCAGGGATGTCTGGG - Intronic
1019789078 7:2998751-2998773 GATCTCAGCCAGGGAGGGCTGGG - Intronic
1024064217 7:45719133-45719155 GGAGGCAGACAGGGTGGGCTGGG + Exonic
1024258790 7:47558825-47558847 GGACATAACCAAGGAGGGCTTGG - Intronic
1026740301 7:72975010-72975032 AGACGCAGCCAGTGAGGGCAGGG - Intergenic
1026768022 7:73172660-73172682 TGCCCCAGCCACCGAGGGCTTGG + Intergenic
1026797608 7:73376519-73376541 AGACGCAGCCAGTGAGGGCAGGG - Intergenic
1027079151 7:75219990-75220012 TGCCCCAGCCACCGAGGGCTTGG - Intergenic
1027103430 7:75390060-75390082 AGACGCAGCCAGTGAGGGCAGGG + Intergenic
1029207640 7:98878899-98878921 GGACGCGGTCACGGAGCGCCCGG + Intronic
1029548617 7:101224362-101224384 AGAAGCAGCCAAGGAGGGCAGGG - Intergenic
1031317339 7:120273588-120273610 GGAGGGAGGCACGGAGGGATGGG + Intergenic
1031918600 7:127585367-127585389 GGTCCCAGGCCCGGAGGGCTGGG + Exonic
1035468008 7:159092221-159092243 GGACACAGCAATGGACGGCTGGG + Intronic
1036079954 8:5544105-5544127 GGAGGCAGCCATGGAAGGCAAGG + Intergenic
1037609816 8:20466585-20466607 GGACACAGCCAGGGAGGGGCAGG - Intergenic
1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG + Intronic
1043190979 8:77222792-77222814 GGACACAGCCAAGGAGTGTTAGG - Intergenic
1047738628 8:127788960-127788982 GGAGGCTGCCAGGTAGGGCTGGG + Intergenic
1049211562 8:141388991-141389013 AGATCCAGCCACGGAGGGCATGG - Intergenic
1049261097 8:141639635-141639657 GGACACAGCCAGGGAGGCCTGGG + Intergenic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049592498 8:143468960-143468982 GGCAGCACCCGCGGAGGGCTTGG + Intronic
1051500881 9:17776391-17776413 GGACCAAGCCTCTGAGGGCTAGG - Intronic
1057274500 9:93669196-93669218 GCACTTAGCCACGGGGGGCTGGG - Intronic
1057929856 9:99184157-99184179 AGACTCAGCCACTCAGGGCTGGG + Intergenic
1058058691 9:100473772-100473794 GGAGGCGGCAACGGAGGGGTGGG - Intronic
1060044209 9:120327216-120327238 GGAAGTGGCCAGGGAGGGCTGGG + Intergenic
1060402647 9:123357336-123357358 GGAGGGAGCCAAGGAGGGCCTGG + Intronic
1062067323 9:134535776-134535798 AGATGCAGCCACTGGGGGCTGGG - Intergenic
1062343334 9:136103528-136103550 GGGGGCAGCCCCTGAGGGCTGGG + Intergenic
1062464891 9:136676552-136676574 GCACCCACCCAGGGAGGGCTGGG + Intronic
1186611697 X:11144076-11144098 GGACGCGGCCCCGGGGGGCTCGG - Exonic
1187390523 X:18883917-18883939 GCAGGCAACCAGGGAGGGCTTGG - Intergenic
1187428795 X:19203193-19203215 GGAGGCAGCCAGGTAGGGCTGGG - Intergenic
1187685569 X:21812464-21812486 GGAAGCAGGCACTGAGTGCTTGG - Intergenic
1190636679 X:52441623-52441645 GGAGGAATCCACGGAGGCCTGGG + Intergenic
1190731281 X:53227583-53227605 GGTCACAGCCACGGTGGCCTGGG - Intergenic
1191942860 X:66499253-66499275 GGATGCAGTCCCGGAGGCCTGGG + Intergenic
1192451169 X:71245955-71245977 GGACCCAGCCAGGAAGGGCAGGG + Intronic
1199982204 X:152927412-152927434 GGAATGAGCCATGGAGGGCTGGG - Intronic
1200069384 X:153520198-153520220 GGATGCAGCCACGGAGTGCCGGG + Intronic