ID: 1152643225

View in Genome Browser
Species Human (GRCh38)
Location 17:81457769-81457791
Sequence CTGGGTAATCAGGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 2, 2: 0, 3: 33, 4: 493}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152643216_1152643225 -1 Left 1152643216 17:81457747-81457769 CCAGGAGGAAGGGCAGGGGTTGC 0: 1
1: 5
2: 6
3: 56
4: 450
Right 1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG 0: 1
1: 2
2: 0
3: 33
4: 493
1152643206_1152643225 29 Left 1152643206 17:81457717-81457739 CCAGGAGGGAGGGCAGGGGTTGC 0: 5
1: 4
2: 11
3: 74
4: 609
Right 1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG 0: 1
1: 2
2: 0
3: 33
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152643225 Original CRISPR CTGGGTAATCAGGAGGGGGA GGG Intronic
900226018 1:1534058-1534080 CTGTGGACTCAGGATGGGGAGGG - Exonic
901055152 1:6445818-6445840 CTGGGTAGCCAGGTGGGGGTGGG - Exonic
901531043 1:9852678-9852700 CTTGCTAATCAGAAGGGGGCTGG + Intronic
901959637 1:12814997-12815019 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
904878553 1:33676106-33676128 CTGGGCAATCAGGCAGGAGAAGG + Intronic
904889665 1:33770439-33770461 CTGGGTACTCAGTAGGGAGTGGG + Intronic
905500814 1:38434720-38434742 CTGGGTCTTAGGGAGGGGGATGG + Intergenic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907646089 1:56244994-56245016 CAGGGCAATCAGGCGGGAGAGGG - Intergenic
908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG + Intergenic
908200738 1:61792864-61792886 CTGGGTAATTAGGGGTGGCAGGG + Intronic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
909928284 1:81464268-81464290 CTGGGTAATGAGGAGAGATAGGG - Intronic
910146911 1:84090929-84090951 CTGGGAAAGCAGGAGGGGTTGGG - Intronic
910512529 1:88022882-88022904 CTGGGTAATAAGCAGAGGTAGGG - Intergenic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
912994442 1:114518830-114518852 GTGGGTGATGAGGAGGGGGAAGG - Intergenic
913452754 1:119003259-119003281 CTGCTTAATCAGGAGGGTGATGG - Intergenic
914376590 1:147078278-147078300 CTGGGTAACCAGGAGCAGGCAGG - Intergenic
914463407 1:147905808-147905830 ATGGGTAATGGAGAGGGGGAAGG - Intergenic
914996721 1:152549784-152549806 CAGGGTAATCAGGCAGGAGAAGG - Intronic
915003565 1:152615597-152615619 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
915994404 1:160549045-160549067 CTTAGTGATCAGGAGAGGGAAGG - Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
917984702 1:180304254-180304276 CAGGGTAATCAGGCAGGAGAAGG + Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
919940483 1:202282650-202282672 CTGGGAAATCAGGTGGGGAGGGG + Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
922746690 1:228048229-228048251 CTGGGAGAGCAGGAGGGAGAAGG - Intronic
923092821 1:230752775-230752797 CTGGGCAATCAAGACAGGGAGGG + Intronic
923621376 1:235582164-235582186 CTGAGTAATCAAGAGAGGCAAGG - Intronic
923849360 1:237776664-237776686 GGGGTTAATCAGGAGGGGAAAGG - Intronic
1063425173 10:5945212-5945234 GTGGTCACTCAGGAGGGGGATGG + Intronic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1069005010 10:63307857-63307879 CTGGGAAATCAGGCTGGGCACGG + Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1070646287 10:78204437-78204459 CTGGGATTTCTGGAGGGGGAAGG + Intergenic
1070784184 10:79153671-79153693 ATGGGTCATGAGGAGGGAGAAGG - Intronic
1071074966 10:81739049-81739071 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1072425976 10:95331249-95331271 CAGGGAAATCAGGATGGGGTGGG - Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1073071249 10:100794569-100794591 ATGGGTAACCAGGATGGTGAGGG - Intronic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1074455970 10:113595317-113595339 CTGGGTAACCATGAGGGGAGTGG - Intronic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075992113 10:126846798-126846820 GTGGGGAGTCAGGACGGGGATGG - Intergenic
1076516356 10:131046887-131046909 CTGGGTGAGCAGGAGGGCCAGGG + Intergenic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077360302 11:2137850-2137872 CTGGGTAACGAGGAGGGGCGCGG - Intronic
1080365038 11:31564520-31564542 CTGGGGTAGCAGGAGGGGAAGGG - Intronic
1081735875 11:45403789-45403811 CTGGGTAATCTAGGAGGGGATGG - Intergenic
1082112079 11:48288167-48288189 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082144091 11:48646191-48646213 CTGGGCAATCAGGCAGGAGAAGG - Intergenic
1082247894 11:49946072-49946094 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082571364 11:54744372-54744394 CTGGGCAGTCAGGAAGGAGAAGG - Intergenic
1083185721 11:61016794-61016816 CTGGGTTAGCAGGCGGGGCAGGG - Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1085475038 11:76784028-76784050 CTGGGACCTCAGGAGGGGGAGGG - Intronic
1085508704 11:77074500-77074522 CTGGCTGATGAGGAGGGGGCTGG - Intronic
1085699014 11:78729724-78729746 CTGGGTGTTCAGGAGGTAGAGGG + Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1091192034 11:133704113-133704135 CTGGGTTATCTGGAGCGGGGAGG + Intergenic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1092025401 12:5235296-5235318 CCGGCTACTCAGGAGGGTGAGGG - Intergenic
1092772798 12:11913301-11913323 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1093243134 12:16702094-16702116 CTGGGACAGCAGGAGGGAGAGGG + Intergenic
1093477103 12:19568212-19568234 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1096525272 12:52206735-52206757 CTGGCTCCTAAGGAGGGGGATGG - Intergenic
1096660469 12:53121038-53121060 CTGGCTTGTCAGGAGGTGGAGGG - Intronic
1096798606 12:54094367-54094389 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1096839250 12:54370589-54370611 CTGGGAATTCAGCAGTGGGAGGG - Intronic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1101028689 12:100638816-100638838 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1101182406 12:102233542-102233564 CTGGGTTTTCTGGAGAGGGAGGG + Intergenic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1104822379 12:131684573-131684595 CAGGGTAGTCGGGAGGGAGATGG - Intergenic
1105322800 13:19344792-19344814 CTCGGGCTTCAGGAGGGGGAAGG - Intergenic
1105629236 13:22145001-22145023 CTAGGCAATCAGGTGGCGGAGGG - Intergenic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1106568812 13:30908563-30908585 CTCGGGAATCAGGAGGTGGGAGG + Intronic
1112961547 13:105133358-105133380 CTGGGCAATCAGGCAGGAGAAGG + Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1114489672 14:23091480-23091502 CTGGCTACTCAGGAGGTGGTGGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119662082 14:76459367-76459389 ATGGGTTATCAGCAGGGAGAAGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121500629 14:94434083-94434105 CTCGGTAACCAGCAGGGGGCAGG + Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1202832681 14_GL000009v2_random:53868-53890 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1123540800 15:21288183-21288205 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1123815202 15:23971206-23971228 CTGGGTAATGGGGAAGGTGATGG - Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125938625 15:43659060-43659082 ATGCATAATCAGGAAGGGGATGG + Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1129392638 15:75228179-75228201 CTGGGCAATCAGGGAGGTGACGG + Intergenic
1129654733 15:77516623-77516645 CTGGGGACTCTTGAGGGGGATGG - Intergenic
1129760628 15:78127380-78127402 CTGGGTCATGAGGAGTGGAAGGG + Intronic
1130042877 15:80419496-80419518 CTGGGTGATCTGGAGGGAGAAGG + Intronic
1130437750 15:83918981-83919003 GTGGGTAAGCAGGAGTGTGATGG + Intronic
1130822309 15:87508516-87508538 CTAGGAAATCAGGAGGTGGAAGG + Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1202949113 15_KI270727v1_random:15325-15347 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136403491 16:30030703-30030725 CTGGGGAGTCGGGAGGGGGCTGG + Exonic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1137994679 16:53197739-53197761 CTAGCTACTCAGGAGGGTGACGG - Intronic
1138441029 16:57035125-57035147 CTGCGTAACCAGGCGGGTGATGG - Intronic
1140194396 16:72844867-72844889 CTCGGAAATGAGGAAGGGGAGGG - Intronic
1140507302 16:75481892-75481914 CTGGTAAAGCAGGAGGGCGATGG + Intronic
1140827288 16:78718590-78718612 CTAGGTACTCTGGAGGGTGACGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141626632 16:85264806-85264828 GTGGGTAACCAGGACCGGGAGGG + Intergenic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141786892 16:86207008-86207030 CTGGTTACTCAGGAGGTTGAGGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142252028 16:88996424-88996446 CTGGGTGAGCAGGATGGGGCTGG - Intergenic
1142717024 17:1752787-1752809 CTGGGTAAGGAGGAGGGTGCGGG + Exonic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143895273 17:10131113-10131135 CTGGGTAACCTGGAGGGGTCAGG - Intronic
1144215349 17:13050346-13050368 ATGGGTGAGAAGGAGGGGGAAGG - Intergenic
1144414124 17:15030140-15030162 CTGGCTACTCAGGAGGCTGAGGG + Intergenic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144998536 17:19287608-19287630 CTTGGAAATCAGCAGTGGGAAGG + Intronic
1145686832 17:26677543-26677565 CAGGGTAATTAGGAAGGAGAAGG + Intergenic
1145721287 17:27075488-27075510 CTGGATGATGAGGAGAGGGAAGG - Intergenic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1147300555 17:39522936-39522958 CTGGCTACTCAGGAGGCTGAGGG + Intronic
1147374640 17:40016360-40016382 AAGGCTAATGAGGAGGGGGAAGG + Intronic
1147738724 17:42657941-42657963 CAGAGGAATCAGGAGAGGGAAGG - Intergenic
1148036650 17:44668446-44668468 CTAGCTACTCAGGAGGAGGAAGG - Intronic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148598726 17:48878011-48878033 CTGGCTACTCAGGAGGCTGAAGG - Intergenic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148861203 17:50605113-50605135 CTGGGAAGTGAGGAAGGGGAAGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149586406 17:57790574-57790596 ATGGGTGTTCAGGATGGGGAGGG - Intergenic
1149614492 17:57987459-57987481 CTGGGTAAACACGAGAGGGGTGG + Intronic
1149721392 17:58848267-58848289 CAGGGTAATCAGGCAGGAGAAGG - Intronic
1149891151 17:60391800-60391822 GTGGGTAACCGGGAGGGAGAGGG - Intronic
1150935896 17:69635284-69635306 CTGGCTAAATAGGAGAGGGAAGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151326378 17:73382287-73382309 CTGGGTACTCAGGTGGGTGTGGG - Intronic
1152326620 17:79645315-79645337 GTGGCTAGTCAGGAGGAGGAGGG - Intergenic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156463265 18:37333481-37333503 CTGGGTATTCCGGAGTGGAAAGG - Intronic
1156483569 18:37450873-37450895 CTGGTTTTTCAGGAGTGGGAAGG + Intronic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156497290 18:37534279-37534301 CTGGGTGCTGGGGAGGGGGAAGG + Intronic
1157097683 18:44701305-44701327 CGGAGTTCTCAGGAGGGGGAAGG - Exonic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1160913695 19:1487066-1487088 CTGGGAAACCAGGAGGGGCGGGG + Intronic
1161158564 19:2748448-2748470 CTGGCTACTCAGGAGGCTGAGGG + Intergenic
1161381704 19:3968901-3968923 CTGGCTAGTCTGGAGGGGGTGGG + Intronic
1162467119 19:10848965-10848987 GTGGGCAATCAGGAGAGAGATGG + Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1165289700 19:34873420-34873442 CTGGGAAGTGAGGCGGGGGAGGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165992764 19:39825777-39825799 CAGGGTCATCAGGAGGCGGGAGG + Exonic
1166545805 19:43634523-43634545 CTGACTCCTCAGGAGGGGGAGGG - Intronic
1167019591 19:46863321-46863343 CTGGGTAAATAGGTGGGGGTTGG + Intergenic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1202640000 1_KI270706v1_random:73863-73885 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
925405932 2:3605471-3605493 GTGGGTGCTGAGGAGGGGGAGGG + Intronic
925405972 2:3605591-3605613 GTGGGTCCTGAGGAGGGGGAGGG + Intronic
925451442 2:3973024-3973046 GTGGGAAATCAGGAGGGTGAAGG - Intergenic
925586373 2:5468706-5468728 ATGGGTAGTCAGGAGGGCAATGG - Intergenic
925853798 2:8110139-8110161 CTGGGGGCTCAGGAGGGTGAGGG + Intergenic
925861595 2:8182697-8182719 CTGGGCAATCAGGCAGGAGAAGG + Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926489180 2:13502908-13502930 CTGGATGGTCAGGAGGGGGGTGG - Intergenic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928795737 2:35016577-35016599 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
929587752 2:43126938-43126960 CTGGGAAATCAGGCTGGGGCTGG - Intergenic
931094758 2:58926697-58926719 TTGGGTATTGAGGTGGGGGAGGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
933737251 2:85504993-85505015 CTGGGTAATGAGGAGGGCACAGG + Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
936915969 2:117639417-117639439 GTGGATAATCAGGAGGCTGAAGG - Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938089916 2:128424751-128424773 CTGTCAAGTCAGGAGGGGGATGG - Intergenic
939544706 2:143538373-143538395 CAGGGTAATCAGGCAGGAGAAGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940929336 2:159408285-159408307 CTGGTTATTCAGGAGGCTGAGGG - Intronic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
941398272 2:164998054-164998076 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
942497470 2:176554607-176554629 GTGGGCGATAAGGAGGGGGAGGG - Intergenic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943425937 2:187733840-187733862 CTGGGCAATCAGGCAGGAGAAGG - Intergenic
944502667 2:200378154-200378176 CTGAGTAATCAGCAGGGGGTTGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945034585 2:205693685-205693707 CTGGGTTACCAGGAAAGGGAGGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
946327386 2:218991855-218991877 CTGGGCACTCAGGACTGGGATGG + Intronic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
948674789 2:239590499-239590521 CTGGGTTATCAGAAAGGTGAAGG + Intergenic
948814984 2:240505948-240505970 CTGGATATTTAGGAAGGGGAAGG - Intronic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
1170519441 20:17168825-17168847 GTGGGAGGTCAGGAGGGGGAAGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1171797813 20:29579973-29579995 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1171850434 20:30304188-30304210 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173187084 20:40848581-40848603 CTGCCTAATCACCAGGGGGAGGG - Intergenic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173853917 20:46237600-46237622 CTGGGAACCAAGGAGGGGGAAGG - Intronic
1174092588 20:48061074-48061096 CTGGCTAAGGAGGAGGGGAATGG - Intergenic
1174171151 20:48618931-48618953 CCTGTTAATCAGGAGGAGGAAGG + Intergenic
1174260054 20:49287420-49287442 ATGGGTAATTAGGAGTGGGAAGG + Intergenic
1174686582 20:52461866-52461888 GTGGCTAAGCAGGAGGGAGAAGG - Intergenic
1175241167 20:57550446-57550468 CTGGGGAATGAGGTGGGGTACGG + Intergenic
1175555778 20:59855226-59855248 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1175942425 20:62543611-62543633 CTGGGGCATCAGGAGAGGCAAGG + Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176190072 20:63804294-63804316 CTGGGCACCCAGGAGGGGGCCGG + Intronic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176700772 21:10047208-10047230 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1178395618 21:32240348-32240370 CTGGGTACTCATGTGGCGGAAGG - Intergenic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1180109355 21:45640917-45640939 CTGGGACATCTGGAGGGGTAGGG - Intergenic
1180195565 21:46191582-46191604 CTAGGTCATCTGGAGTGGGAGGG + Intronic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180870938 22:19147062-19147084 GTGGATGATCAGGAGAGGGAGGG + Intergenic
1181579035 22:23816749-23816771 CTCTGAAATCAGGAGAGGGAAGG - Exonic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1182351676 22:29703285-29703307 CTGGCGAGTGAGGAGGGGGAAGG - Intergenic
1182560090 22:31152869-31152891 CTGGGTAGTGTGGAGAGGGAGGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1183929440 22:41227657-41227679 CTGGGCAATGAGGAGAGGGCGGG - Intronic
1184051420 22:42008322-42008344 CTGGCTACTCAGGAGGCTGAGGG - Intronic
1184215757 22:43066273-43066295 CTGGGTCATCAGGAAGGAAATGG + Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1184690340 22:46114556-46114578 CTGGGTCAACAGGAGGGGCGAGG - Intergenic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185026693 22:48418052-48418074 CTGGCAAATCGGGAGGGAGAGGG + Intergenic
1185075161 22:48679024-48679046 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075228 22:48679216-48679238 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075425 22:48679730-48679752 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185270507 22:49927521-49927543 GTAGGTAATCAGGAGGAGAACGG + Exonic
1185282126 22:49977001-49977023 CTGGCTACTCAGGAGGTGGCTGG - Intergenic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
951816296 3:26758828-26758850 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
951963485 3:28355000-28355022 CAGGGTAATCAGGCAGGAGAAGG + Intronic
951964360 3:28366137-28366159 CAGGGTAATCAGGCAGGAGAAGG - Intronic
952794031 3:37223200-37223222 GGGGGTAAGCAGGAGGGGGTTGG + Intergenic
953109712 3:39922072-39922094 CTGGGTACTGAGGAGTGGCATGG + Intronic
953266040 3:41389365-41389387 CAGGGTAATCAGGCAGGAGAAGG - Intronic
953629295 3:44598882-44598904 CTAGGTACTCAGGAGGCTGAGGG + Exonic
954274403 3:49532986-49533008 TGGGGTACTCAGGAGGGGGTAGG - Exonic
954987245 3:54806200-54806222 CAGGGCAATCAGGCGGGAGAAGG + Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
959585475 3:108021443-108021465 CTGGGAAATAAGGTGGGGCATGG + Intergenic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
962949511 3:140204991-140205013 TTGGGGAATCAGGAGGGGTGAGG + Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
964724365 3:159799037-159799059 TTGGGTAATGAAGAGGGAGAGGG + Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
967736413 3:192957355-192957377 CTGGGGAATCAGGGGGGTTATGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970350257 4:15195200-15195222 TTGGGTAAACGGGAGGGTGAGGG - Intergenic
970676401 4:18455190-18455212 CTAGGAGATCAGGAGGGGCAAGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972662437 4:41129333-41129355 CTGTGTAGTCAGGAGGGTGTTGG - Intronic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
974111750 4:57533847-57533869 CGGGGTAATCAGGCAGGAGAAGG - Intergenic
976177913 4:82373381-82373403 CGGGGGAATAAAGAGGGGGAGGG + Intronic
976850921 4:89542945-89542967 GTGGGTTATCAGGTGGGGGTAGG - Intergenic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977897034 4:102376745-102376767 CAGGGCAATCAGGTGGGAGAAGG - Intronic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978565856 4:110080739-110080761 CAGGGTAATCAGGCAGGAGAAGG + Intronic
978590884 4:110323814-110323836 CGGGGTAATCAGGCAGGAGAAGG - Intergenic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
980457569 4:133065520-133065542 CCGGGAAATCTGGAGAGGGATGG + Intergenic
980925793 4:139136107-139136129 CTGGGTAATCTAGGAGGGGATGG + Intronic
981605080 4:146531640-146531662 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
984507105 4:180633624-180633646 CTGGGGACTCCAGAGGGGGATGG + Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
986761963 5:10888371-10888393 CTGAGAAATCAGGAGAGAGATGG - Intergenic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
988274108 5:29058085-29058107 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
988483094 5:31645930-31645952 CAGTGTACTCAGTAGGGGGAAGG + Intronic
990084349 5:51955931-51955953 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991383559 5:66059531-66059553 CAGGGTAATCAGGCAGGAGAAGG - Intronic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
994691836 5:103029051-103029073 CTTGGTTTTCAGGAGGAGGAAGG - Exonic
995383923 5:111567583-111567605 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
998736793 5:145151249-145151271 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1002056939 5:176603550-176603572 CTGGCTTATGAGGTGGGGGAGGG + Intronic
1002105098 5:176876124-176876146 CTGGGTACTCAGGACGGCGAAGG - Intronic
1002293066 5:178212754-178212776 CTGGGCTGTCAGGAGGTGGAAGG - Intronic
1002591914 5:180296253-180296275 CTGGGAAATCTGGTGGGGGTGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1005205542 6:23399293-23399315 CTGGGGACTCAGGAGGGAAAGGG - Intergenic
1005558520 6:27012557-27012579 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006516058 6:34546363-34546385 CTGGGACAGCAGGAGGGGAAGGG + Intronic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007472414 6:42099431-42099453 CTGGGTAGGCAGGTGGGGGCAGG + Intergenic
1007632191 6:43278748-43278770 CTGGGCATTCAGGAGAGGCAGGG + Intronic
1008717794 6:54310195-54310217 CTGGCTACTCAGGAGGCTGAGGG - Intronic
1009159102 6:60259532-60259554 CTGGCTACTCAGGAGGCTGAGGG - Intergenic
1009517184 6:64635316-64635338 CAGGGCAATCAGGCGGGAGAAGG - Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010742287 6:79522793-79522815 CTGGCTACTCAGGAGGTGGGAGG - Intronic
1012339301 6:98099686-98099708 CTGGGTCTTCCTGAGGGGGAAGG - Intergenic
1015973164 6:138762956-138762978 CTGGGGGGTCAGGAGGGGCAAGG - Intronic
1016213688 6:141570118-141570140 CTGGGCAATCAGGCAGGAGAAGG + Intergenic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1019179661 6:170178341-170178363 CTGGGTAGGCAGGAGGGTGCCGG + Intergenic
1019215824 6:170443282-170443304 GTCTGTAATCAGGAGGGGGCTGG - Intergenic
1019415382 7:924501-924523 CTGTGTAATCTGGAGGGCGGGGG - Intronic
1019615511 7:1957784-1957806 CTGGGTGATAAGGAGGTGAAAGG + Intronic
1021199718 7:17714929-17714951 GTGGGCAATCAGGAGAGGGATGG - Intergenic
1021510417 7:21427687-21427709 CTGGGAAATGAGTAGGGGGCGGG + Intergenic
1023138127 7:37074527-37074549 CTGGGTTCCCAGGAGGGCGAGGG + Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1024302977 7:47902187-47902209 CTGGGTCCTCAGGGGAGGGAGGG - Intronic
1024444937 7:49466121-49466143 CTGGGTAATTAAGAGGTGGCAGG + Intergenic
1024633103 7:51265262-51265284 CTGGGAAAGCAGGTGGGGGTTGG + Intronic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1028887649 7:95952209-95952231 ATGGGTAATCTGGGGCGGGAAGG - Intronic
1028996391 7:97105037-97105059 CTAGGAAGTCAGGAGGGGGTAGG + Intergenic
1029102153 7:98140253-98140275 CTGGCTACTCAGGAGGCTGAGGG - Intronic
1029534024 7:101145311-101145333 CTGGGTTATCAGGAGGGAGGAGG - Intergenic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1032634669 7:133693552-133693574 CTGTGTAATTAGGAGTGTGATGG - Intronic
1032866745 7:135933466-135933488 CTGGCAAATTAGGAGGTGGAGGG - Intronic
1033662116 7:143409191-143409213 CTGGGTAATAGGGCCGGGGAAGG + Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035018306 7:155785541-155785563 CTGGGGGCTCAGGAAGGGGATGG - Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1036050522 8:5191149-5191171 CTGGGCAATCAGGCAGGAGAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1037502267 8:19497424-19497446 ATGAGTAGTCAGGAGGGGGCTGG - Intronic
1037547409 8:19938440-19938462 CTGGGTAATTAATAGGGGAAGGG - Intronic
1037577993 8:20225836-20225858 CTGGGTTATCCAGAGAGGGAGGG + Intronic
1038282528 8:26178922-26178944 CTGGGTAATGAGGAGAGGCTGGG + Intergenic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1040101180 8:43507345-43507367 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1040541035 8:48355875-48355897 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1042312198 8:67390155-67390177 CTGGGTCATCAGGAATGGGTAGG + Intergenic
1043499205 8:80836438-80836460 ATGGGGAATGAGGAGGGAGAGGG - Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047368446 8:124234536-124234558 CAGGGTAATAAGGTGGGTGAGGG - Intergenic
1047869731 8:129069699-129069721 CTGGGATATTAGGAGAGGGAGGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1049684424 8:143933668-143933690 CTGGGCAATCAGCAGTGGGTTGG + Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050007512 9:1148345-1148367 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1050960223 9:11720670-11720692 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1051152442 9:14097895-14097917 CTGGTTGGTCAGGAGAGGGAGGG - Intronic
1051599099 9:18854254-18854276 CTGGGCAATAAGGAGAGGAAGGG - Intronic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1052770869 9:32688264-32688286 CTGGGCAATCAGGCAGGAGAAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053637913 9:40033710-40033732 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1053718368 9:40919923-40919945 CAGGGTAATCAGGCAGGAGAGGG + Intergenic
1053768169 9:41431510-41431532 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1053788214 9:41667479-41667501 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1054156925 9:61647289-61647311 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054176494 9:61878818-61878840 CTGGGAATTCAGGTGGGGGGGGG - Intergenic
1054476697 9:65578297-65578319 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054546837 9:66343014-66343036 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1056115169 9:83434526-83434548 CTGGGTAAGCAGGAAGGGATGGG - Intronic
1056261987 9:84858150-84858172 CTGGGTATTGGGGAAGGGGAAGG - Intronic
1056587162 9:87936188-87936210 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1056609713 9:88116755-88116777 CTGGGAAATAAGAACGGGGATGG + Intergenic
1057324311 9:94046839-94046861 CTGGGCAATCAGGCAGGAGAAGG - Intronic
1057411050 9:94816737-94816759 CTGGGTTAGGAGGTGGGGGAAGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060279078 9:122203964-122203986 CTGGATAATTAGGTGGGGGTAGG + Exonic
1061122492 9:128652506-128652528 CTAGGTACTCAGGAGGCTGACGG + Intronic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1062330998 9:136044900-136044922 CTGGGTGTTCAGCCGGGGGATGG + Intronic
1062461085 9:136662857-136662879 CTGGGTAATCGGGATTGGGATGG - Intronic
1202785783 9_KI270719v1_random:17266-17288 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203548114 Un_KI270743v1:144594-144616 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1186465154 X:9779203-9779225 CAGGGTAGTCAGGAGGGGTGTGG - Intronic
1187453594 X:19421180-19421202 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190441193 X:50475960-50475982 GTAGGTAAGCAGGAGTGGGATGG + Intergenic
1190967914 X:55319826-55319848 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1191233070 X:58112239-58112261 CAGGGAAATCAGGCAGGGGAAGG + Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1192073465 X:67965271-67965293 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1192895915 X:75442300-75442322 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1193735453 X:85150963-85150985 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194630189 X:96273512-96273534 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1195149304 X:102049318-102049340 CTGGGCAATCAGGCAGGAGAAGG - Intergenic
1195408925 X:104547848-104547870 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1195414974 X:104610279-104610301 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1196077167 X:111590692-111590714 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198928938 X:141831341-141831363 CTTGGAAATGAGGATGGGGAAGG - Intergenic
1200125541 X:153812480-153812502 CTGGGATGTCAAGAGGGGGATGG + Intronic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201974690 Y:19836096-19836118 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1202082704 Y:21100994-21101016 CTGGCTACTTAGGAGGGTGAGGG + Intergenic