ID: 1152643321

View in Genome Browser
Species Human (GRCh38)
Location 17:81458010-81458032
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 2, 1: 1, 2: 1, 3: 40, 4: 435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152643301_1152643321 28 Left 1152643301 17:81457959-81457981 CCGGGGGGAGGGCAGGGGTTGCT 0: 3
1: 2
2: 6
3: 48
4: 464
Right 1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG 0: 2
1: 1
2: 1
3: 40
4: 435
1152643312_1152643321 -1 Left 1152643312 17:81457988-81458010 CCAGGAGGGAGGGCAGGGGTTGC 0: 5
1: 4
2: 11
3: 74
4: 609
Right 1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG 0: 2
1: 1
2: 1
3: 40
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
901051064 1:6426126-6426148 CTGGGTGACCTGGAGATGGAAGG + Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901055152 1:6445818-6445840 CTGGGTAGCCAGGTGGGGGTGGG - Exonic
901260869 1:7869605-7869627 CTAGGTCACCAGGATGGTGATGG - Intergenic
902350445 1:15849602-15849624 CTGAGAAACCAGGCGGGGGCGGG + Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903034895 1:20486780-20486802 CAGGGCCTCCAGGAGGGGGAGGG + Intergenic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
904907197 1:33906594-33906616 CTGGATAACTAGGTGGGGAATGG + Intronic
904923347 1:34026294-34026316 CTTGGTAACCATAAGGGGAAAGG - Intronic
905821081 1:40991986-40992008 TTGGGGAACCAGGAGAGGCAGGG - Intronic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
908062137 1:60362700-60362722 TTGGGTAACCAGGATGGAGGAGG + Intergenic
908253878 1:62286752-62286774 CTGGGGCCCCAGGAGGGGGTAGG - Intronic
909987810 1:82184021-82184043 CTTGCTACCCAGGAGGGAGAGGG + Intergenic
910146911 1:84090929-84090951 CTGGGAAAGCAGGAGGGGTTGGG - Intronic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
912994442 1:114518830-114518852 GTGGGTGATGAGGAGGGGGAAGG - Intergenic
913452754 1:119003259-119003281 CTGCTTAATCAGGAGGGTGATGG - Intergenic
914376590 1:147078278-147078300 CTGGGTAACCAGGAGCAGGCAGG - Intergenic
914845874 1:151283165-151283187 CTGGGTTTCGAGGAGGGGGCGGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
916823495 1:168423111-168423133 CCAGGTAGCCAGGAGAGGGAAGG + Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
919606226 1:199688105-199688127 CTGGCTAACCAGCTGGGGTAAGG - Intergenic
919866996 1:201789868-201789890 TTGGGTAACTGGGCGGGGGATGG + Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920279124 1:204829686-204829708 TTGGGAAACTAGGATGGGGAAGG + Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
922718162 1:227887499-227887521 GTGGGTCACCAGGGAGGGGAGGG + Intergenic
922721184 1:227901093-227901115 CTGGGTAACTGGGAGTAGGAGGG + Intergenic
922724313 1:227915349-227915371 CTGTGTAGCCAGGTGGGGCAGGG + Intergenic
922746690 1:228048229-228048251 CTGGGAGAGCAGGAGGGAGAAGG - Intronic
922814834 1:228441206-228441228 CTTTGAAACCAGGAGGGAGAAGG + Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1067272650 10:44805426-44805448 CTGGGGATCCAGCAGGGGAAAGG + Intergenic
1067297397 10:44982623-44982645 CTGGGCATCCATGAGGTGGAGGG - Exonic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1068208276 10:53886297-53886319 CTGTGTAACCAGGAGTGGACAGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069623667 10:69853276-69853298 CTGGGGTGCCAGGTGGGGGATGG - Intronic
1069724724 10:70569791-70569813 ATGTGTACCCAGGAGTGGGATGG - Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070801808 10:79248312-79248334 CTTGGAAACCAGGAGAGGTATGG + Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1073071249 10:100794569-100794591 ATGGGTAACCAGGATGGTGAGGG - Intronic
1074455970 10:113595317-113595339 CTGGGTAACCATGAGGGGAGTGG - Intronic
1076516356 10:131046887-131046909 CTGGGTGAGCAGGAGGGCCAGGG + Intergenic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1077320389 11:1938371-1938393 GTGGGGGACCAGGAGGGGCATGG + Intronic
1077360302 11:2137850-2137872 CTGGGTAACGAGGAGGGGCGCGG - Intronic
1077485732 11:2837646-2837668 CAGCCAAACCAGGAGGGGGAAGG + Intronic
1077721663 11:4636512-4636534 CTGGATAACAGGGTGGGGGATGG - Intergenic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1078567615 11:12430479-12430501 CTGTGTGTCCAGGAGGGGCAAGG - Intronic
1079630259 11:22666482-22666504 CTGGGGGACAAGGAGGGGGCTGG + Intronic
1080094923 11:28394470-28394492 CTGGCTCACAAGGAGGGGGGTGG + Intergenic
1080365038 11:31564520-31564542 CTGGGGTAGCAGGAGGGGAAGGG - Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081026297 11:38019277-38019299 CTGGGGCACCAGGAGAGGCAAGG - Intergenic
1081625830 11:44654546-44654568 TTGGGCAACCAGGTGGGGAATGG - Intergenic
1081694911 11:45102963-45102985 CTGTTTACCCTGGAGGGGGAAGG + Intronic
1082186273 11:49185675-49185697 CTGGGTAACCTGGTGTGAGAGGG + Exonic
1083185721 11:61016794-61016816 CTGGGTTAGCAGGCGGGGCAGGG - Intronic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1083827131 11:65210248-65210270 TTGGGTCCCCAGGAGGGGGCTGG - Intronic
1084199086 11:67543424-67543446 CTGGGGTACCAGCATGGGGAGGG + Intergenic
1084272061 11:68034256-68034278 CTGGGTAGCCCGCTGGGGGAGGG - Intronic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1085475038 11:76784028-76784050 CTGGGACCTCAGGAGGGGGAGGG - Intronic
1086158661 11:83696093-83696115 CTTGGCAACCAGGTGGAGGATGG + Intronic
1086680058 11:89659696-89659718 CTGGGTAACCTGGTGTGAGAGGG - Intergenic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1088812111 11:113399063-113399085 CTGGGCCACCAGGAAGTGGAGGG - Exonic
1088907593 11:114166242-114166264 GTGTGTAACCATGAGGGAGAGGG + Intronic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1090441397 11:126728188-126728210 TTGGGACACCAGGAGGGGCAGGG + Intronic
1090730803 11:129572071-129572093 CTGGGTATCCAGGATGTGTAGGG - Intergenic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1093243134 12:16702094-16702116 CTGGGACAGCAGGAGGGAGAGGG + Intergenic
1093587271 12:20854660-20854682 CTGGCTAACTGGGAGGGGAATGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1096777093 12:53970881-53970903 CTGGAGGGCCAGGAGGGGGAAGG + Intergenic
1096798606 12:54094367-54094389 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1096842946 12:54390452-54390474 CGGGGGCACCAGGAGAGGGAGGG - Intronic
1097876273 12:64647162-64647184 CTGGGGTGCCAGGAGGTGGAGGG - Intronic
1098455415 12:70667463-70667485 ATGGGTAACCAGGGGGTTGATGG - Intronic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1102001951 12:109562962-109562984 GTGGGCTACCAGGAGGGTGAAGG + Intronic
1102687125 12:114734008-114734030 CTGGGAATCCAGGTGAGGGAGGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103994654 12:124821312-124821334 CTGAGAAACCAGGTGGGAGAGGG - Intronic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104916431 12:132267212-132267234 CAGGGGAACCAGGGCGGGGAAGG + Intronic
1105840885 13:24252804-24252826 CTGGGGAACCAGGCTAGGGAAGG + Intronic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1110713105 13:78671587-78671609 CTGGGAATCCAGGAGGTAGAAGG + Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1112707406 13:102086326-102086348 CTGGCTAACCAGGATAGAGACGG + Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113791283 13:113029712-113029734 CTGGGAGACCAAGAGAGGGAGGG + Intronic
1115069642 14:29305182-29305204 CTGGCTTACAAGGAGGGAGATGG + Intergenic
1115566538 14:34629843-34629865 CCGGGGACCCAGGATGGGGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116931495 14:50695343-50695365 CTGGGTAACAGGCAGGGGGTTGG - Intergenic
1117105807 14:52395841-52395863 CTGGGTGTCCCGGAGGGAGAGGG - Intergenic
1119869934 14:78008392-78008414 CTGGCACACCAGGAGGGAGAAGG - Intergenic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121406667 14:93723205-93723227 CTGGGAACCCTGGAGGGGGCTGG - Intronic
1121500629 14:94434083-94434105 CTCGGTAACCAGCAGGGGGCAGG + Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1123003785 14:105311767-105311789 CTGGGAAGCCATGTGGGGGATGG - Exonic
1124204305 15:27704045-27704067 GTGCGGAACAAGGAGGGGGAGGG + Intergenic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1127007514 15:54586811-54586833 CTGGCTAACCAGGAGCTGGCTGG - Intronic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1129038680 15:72666014-72666036 GTGGGCAACCATGAGGGGCATGG + Exonic
1129211211 15:74071216-74071238 GTGGGCAACCATGAGGGGCATGG - Exonic
1129399192 15:75269871-75269893 GTGGGCAACCATGAGGGGCATGG + Exonic
1129402799 15:75294147-75294169 GTGGGCAACCATGAGGGGCATGG + Exonic
1129644797 15:77420052-77420074 CGTGGTCACCAGGAAGGGGACGG - Exonic
1129688523 15:77700080-77700102 CTGGGGAACCAGCAGAGGGGAGG + Intronic
1129728344 15:77915490-77915512 GTGGGCAACCATGAGGGGCATGG - Intergenic
1130042877 15:80419496-80419518 CTGGGTGATCTGGAGGGAGAAGG + Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130437750 15:83918981-83919003 GTGGGTAAGCAGGAGTGTGATGG + Intronic
1130822309 15:87508516-87508538 CTAGGAAATCAGGAGGTGGAAGG + Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133246824 16:4454720-4454742 CTGGGTGGCCAGGCGGGGGTAGG + Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1133981402 16:10635706-10635728 CTGGGAATCCAGGAACGGGAAGG - Intronic
1135040236 16:19112765-19112787 CTGTGTAACCTTGTGGGGGAGGG + Intergenic
1135991613 16:27222025-27222047 TGGGGTAACTAGAAGGGGGATGG + Intergenic
1137379441 16:47983839-47983861 CTGGGTCCCCAGGAGAGAGATGG + Intergenic
1138149665 16:54644544-54644566 CTGGGAAGCCGGGAGGGAGAGGG - Intergenic
1138441029 16:57035125-57035147 CTGCGTAACCAGGCGGGTGATGG - Intronic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1140507302 16:75481892-75481914 CTGGTAAAGCAGGAGGGCGATGG + Intronic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1140869866 16:79096464-79096486 TGGGATAACCAGGAGGGGCATGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141450342 16:84095642-84095664 CTGGGCAACCTGGCGCGGGATGG + Exonic
1141626632 16:85264806-85264828 GTGGGTAACCAGGACCGGGAGGG + Intergenic
1141642817 16:85351185-85351207 CTGGATGCCCAGGAGGGAGAGGG + Intergenic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142113634 16:88345160-88345182 CTGGGTGCCCGGGAGGGGGCTGG - Intergenic
1142252028 16:88996424-88996446 CTGGGTGAGCAGGATGGGGCTGG - Intergenic
1142265929 16:89063966-89063988 GTGGGTGACCAGGGTGGGGATGG - Intergenic
1142429414 16:90018501-90018523 CTAGGAAACCAGGAGGTGGTGGG + Intronic
1142641764 17:1288987-1289009 ATGGGGAACCCGGTGGGGGATGG - Intronic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1142717024 17:1752787-1752809 CTGGGTAAGGAGGAGGGTGCGGG + Exonic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143895273 17:10131113-10131135 CTGGGTAACCTGGAGGGGTCAGG - Intronic
1144215349 17:13050346-13050368 ATGGGTGAGAAGGAGGGGGAAGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1145895490 17:28455344-28455366 CTGGAGAACCAGGAAGGTGAGGG - Intergenic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1147158853 17:38559291-38559313 CTGGGGCTCCAGGAGGGCGATGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147562992 17:41520352-41520374 GTGGGGATCCAGGAGGGGGCAGG - Exonic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149614492 17:57987459-57987481 CTGGGTAAACACGAGAGGGGTGG + Intronic
1149687081 17:58542185-58542207 CTGGGATTCCAGGAGGGGAAAGG - Intronic
1149891151 17:60391800-60391822 GTGGGTAACCGGGAGGGAGAGGG - Intronic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1150392450 17:64797911-64797933 ATGGGTAGCCAGCAGGGGGCAGG + Intergenic
1150676296 17:67247417-67247439 GTAGGTATCCAGGAGGGGCAGGG - Intergenic
1150935896 17:69635284-69635306 CTGGCTAAATAGGAGAGGGAAGG - Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151728553 17:75897991-75898013 CTGGCTAACTAGTAGGTGGAGGG - Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1155821270 18:30380860-30380882 CTGGGTAACAGGGAGGGGATTGG - Intergenic
1156263503 18:35466476-35466498 GGGGGTGTCCAGGAGGGGGATGG - Intronic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1157385095 18:47253684-47253706 CAGGGTAACCTGGAATGGGAGGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158085794 18:53650432-53650454 CTAAGTAACCAGGAGAGGGTCGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1160387723 18:78506593-78506615 CTCGGTAACCAGGAGGTCGGAGG + Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160913695 19:1487066-1487088 CTGGGAAACCAGGAGGGGCGGGG + Intronic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161808676 19:6459414-6459436 TTGGGTAACCGGGAGCGGGCGGG + Intronic
1162080310 19:8214111-8214133 CTGGGAGTCCAGGAGGGGGTAGG - Intronic
1162746435 19:12801386-12801408 CCGGGTACCCGGGAGGGTGAGGG - Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163616668 19:18333163-18333185 CTAGGGAGCCAGGTGGGGGAAGG - Intergenic
1164855666 19:31518688-31518710 CCCGGTACCTAGGAGGGGGAAGG + Intergenic
1164940686 19:32250797-32250819 CTTGATAACCAAGAAGGGGAGGG - Intergenic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165432937 19:35782677-35782699 CAGGTAAACCAGGAGGGGCAGGG + Exonic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166569167 19:43782885-43782907 CTAGGACACAAGGAGGGGGAGGG - Intergenic
1167019591 19:46863321-46863343 CTGGGTAAATAGGTGGGGGTTGG + Intergenic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167583760 19:50361484-50361506 GTGCGTCACAAGGAGGGGGAGGG - Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1168137144 19:54359518-54359540 CTGGGACACCCGGAGAGGGACGG - Intronic
1168160932 19:54509567-54509589 CTGGGACACCCGGAGAGGGACGG + Intronic
1168614953 19:57830142-57830164 CTAGGTAACAAGGAGGGTAAAGG - Intronic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
925405901 2:3605383-3605405 GTGGGTGCCGAGGAGGGGGAGGG + Intronic
925451442 2:3973024-3973046 GTGGGAAATCAGGAGGGTGAAGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927937746 2:27085085-27085107 CTGGGGATCCAGCAGGGGAAGGG + Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
929659775 2:43772340-43772362 CTTGGTAACCAGGAAAGTGAAGG - Intergenic
929891121 2:45919277-45919299 CTTGGAAACCAGGTGTGGGAAGG + Intronic
931282383 2:60805548-60805570 CTGTCTAACCAGTAGGGGGTAGG + Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
934576739 2:95406650-95406672 CGGGGTAACCGGAAGGGGAAAGG + Intronic
934638958 2:96014818-96014840 CGGGGTAACCGGAAGGGGAAAGG + Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
936452112 2:112641555-112641577 CTTGGGATCCAGGTGGGGGAAGG - Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937539140 2:122926693-122926715 CTGGGGATCCTGGAGGGAGAGGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938389918 2:130896984-130897006 CTGGATCACCAGGCTGGGGAAGG + Intronic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
940606617 2:155932117-155932139 CTGGGTTGCTAGGAGTGGGATGG - Intergenic
942320284 2:174730349-174730371 CTGGGAAACCCGGAGGGGAGGGG + Intergenic
944502667 2:200378154-200378176 CTGAGTAATCAGCAGGGGGTTGG - Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945034585 2:205693685-205693707 CTGGGTTACCAGGAAAGGGAGGG - Intronic
945988441 2:216372519-216372541 GGAGGTAACCAGGAGAGGGAGGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946192766 2:218016157-218016179 CTGGTTTCCCAGGAAGGGGAGGG - Intergenic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
947711038 2:232315967-232315989 CCGGGTTACCAGTAGGGGGTAGG + Intronic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
1169058299 20:2641730-2641752 TTCCCTAACCAGGAGGGGGATGG + Exonic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171797813 20:29579973-29579995 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1171850434 20:30304188-30304210 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173853917 20:46237600-46237622 CTGGGAACCAAGGAGGGGGAAGG - Intronic
1174092588 20:48061074-48061096 CTGGCTAAGGAGGAGGGGAATGG - Intergenic
1174260054 20:49287420-49287442 ATGGGTAATTAGGAGTGGGAAGG + Intergenic
1174686582 20:52461866-52461888 GTGGCTAAGCAGGAGGGAGAAGG - Intergenic
1175238070 20:57526561-57526583 CTGGGAGACCTGGAGGGGAAAGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176190072 20:63804294-63804316 CTGGGCACCCAGGAGGGGGCCGG + Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179719880 21:43309068-43309090 CTGGGGACCGAGGAGGGGCATGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179908177 21:44434902-44434924 CGGGGTCACCTGGTGGGGGAAGG - Intronic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180959757 22:19757201-19757223 CTGGTCAACCAGAAGGGCGACGG - Intronic
1181314965 22:21964961-21964983 CTTAGTAACGAGGAGGGGGTTGG - Intronic
1181413797 22:22745281-22745303 GTGCTTAACCAGGATGGGGAGGG - Intronic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1182350034 22:29694226-29694248 CTGGGAAACCAGGAGTAGAAGGG + Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183364548 22:37400092-37400114 CTAGGAAACCGGGAGGGGCAAGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183754399 22:39746734-39746756 CTGGGAGGCCAGCAGGGGGAGGG + Intronic
1184072923 22:42157209-42157231 CTGGGTATCCTGGAGGGGATTGG + Intergenic
1184651376 22:45920776-45920798 CTGGGTACCGGAGAGGGGGATGG - Exonic
1184690340 22:46114556-46114578 CTGGGTCAACAGGAGGGGCGAGG - Intergenic
1184697783 22:46149829-46149851 CGGGGGAACGAGGAGGGTGAAGG - Intergenic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185048215 22:48539824-48539846 CTGGGTAACAAGGAGCCAGATGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185075161 22:48679024-48679046 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075228 22:48679216-48679238 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075425 22:48679730-48679752 CTGGGGAGCCAGGAGAGGGATGG - Intronic
950474495 3:13206987-13207009 GTGGCTAACCAGGAGGCGGGAGG - Intergenic
951881367 3:27484060-27484082 CCGGGTAACGAGCAGGGTGAGGG - Intronic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952348094 3:32507478-32507500 CTGGGTAACAAGGAGATTGAGGG + Intergenic
952794031 3:37223200-37223222 GGGGGTAAGCAGGAGGGGGTTGG + Intergenic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953387160 3:42513201-42513223 CTGGGTCACCAGGCTAGGGAGGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
957238511 3:77626560-77626582 TTGGGTAACGGGGAGGGAGAGGG + Intronic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962382427 3:134908699-134908721 GTGGGAAACAAGGAGGGAGAAGG + Intronic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969697298 4:8742006-8742028 GTGGGTCACTGGGAGGGGGATGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970350257 4:15195200-15195222 TTGGGTAAACGGGAGGGTGAGGG - Intergenic
970423961 4:15929583-15929605 CTGGGAAACCAGGCAGGGCAAGG - Intergenic
979093389 4:116516253-116516275 TAGGGTAACCTGGAGGGGGCTGG + Intergenic
981835998 4:149054184-149054206 CTGACCAACCTGGAGGGGGAAGG - Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
985553991 5:547238-547260 CTGGGTCTCTAGGAGGGGGCGGG - Intergenic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990585541 5:57207714-57207736 ATGGGAAGCCAGGAGGGAGATGG + Intronic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
991577101 5:68115966-68115988 CTGTGTATCCAGGATGGAGAAGG + Intergenic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
998514056 5:142736998-142737020 CTGGGAAACCTGGAGGGTGGAGG - Intergenic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
998920166 5:147059455-147059477 CAGGGTCACCAGGAGAGGAATGG + Intronic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000885875 5:166746718-166746740 GTGGGTAGCCAGGAGGGAGCAGG - Intergenic
1002105098 5:176876124-176876146 CTGGGTACTCAGGACGGCGAAGG - Intronic
1002189212 5:177470102-177470124 CCGGGAATCCAGGAAGGGGAGGG - Intronic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006305160 6:33214187-33214209 CTGGGGACCCGGGAGGGGGCAGG - Intergenic
1006516058 6:34546363-34546385 CTGGGACAGCAGGAGGGGAAGGG + Intronic
1006718100 6:36132730-36132752 CTGGGGAGCAAGGTGGGGGAGGG + Intronic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007472414 6:42099431-42099453 CTGGGTAGGCAGGTGGGGGCAGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011216889 6:85014673-85014695 CTGGGTCACTGGGTGGGGGAGGG + Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1013099473 6:106974848-106974870 CTGGGGAACCCGGAGCGGGGCGG - Intronic
1013620317 6:111881307-111881329 CTGGGAAACAAGGAAGGAGAGGG + Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017966071 6:159267393-159267415 ATGTGTAACTAGGAGGGGGCGGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1019179661 6:170178341-170178363 CTGGGTAGGCAGGAGGGTGCCGG + Intergenic
1019415282 7:924167-924189 CTGTGTAACCTGGAGGGCGGGGG - Intronic
1019415291 7:924205-924227 CTGTGTAACCTGGAGGGCGGGGG - Intronic
1019415372 7:924462-924484 CTGTGTAACCTGGAGGGTGGGGG - Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020573122 7:9890891-9890913 CTGGGTCACCTGGAGGTGGGTGG - Intergenic
1021199718 7:17714929-17714951 GTGGGCAATCAGGAGAGGGATGG - Intergenic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023138127 7:37074527-37074549 CTGGGTTCCCAGGAGGGCGAGGG + Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1024054585 7:45651791-45651813 CTGAGTGACCAGGAAGGAGAGGG + Intronic
1024633103 7:51265262-51265284 CTGGGAAAGCAGGTGGGGGTTGG + Intronic
1024797540 7:53036516-53036538 CTGGGTGACCTCGAGGGCGAAGG - Exonic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1028743879 7:94306313-94306335 CTGAGTAACTGGCAGGGGGAGGG - Intergenic
1029253118 7:99250973-99250995 CTGGGAACCCAGGAGGAGAATGG - Intergenic
1029290629 7:99499864-99499886 CTGCGTTACCAGGAGGTGGCTGG - Exonic
1029534024 7:101145311-101145333 CTGGGTTATCAGGAGGGAGGAGG - Intergenic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1032533327 7:132639621-132639643 CTGGGGAACCAGGTAGGGGTGGG - Intronic
1034099771 7:148440513-148440535 CTTTGTACCCAGGACGGGGAGGG + Intergenic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035349582 7:158236695-158236717 CTGGGTGACCAGGCGGGGACAGG - Intronic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1037226783 8:16602235-16602257 ATCGGGAGCCAGGAGGGGGATGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1043989749 8:86738420-86738442 CTGGGTAACAAGGGGAGAGATGG + Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048855974 8:138686767-138686789 ATTGGTAACCTGGAAGGGGATGG - Intronic
1049658300 8:143808550-143808572 CTGGGTGCCCAGGAGGGCCAGGG + Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049792729 8:144479386-144479408 CTCGAGCACCAGGAGGGGGAAGG - Intronic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053788214 9:41667479-41667501 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1054156925 9:61647289-61647311 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054476697 9:65578297-65578319 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1056115169 9:83434526-83434548 CTGGGTAAGCAGGAAGGGATGGG - Intronic
1056844252 9:90023772-90023794 TTGGGCTGCCAGGAGGGGGACGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057143885 9:92745622-92745644 CTGGGTGCCCAGGGGAGGGAGGG + Intronic
1057225313 9:93289734-93289756 GTGGGTCACCAAGAGAGGGACGG - Intronic
1057411050 9:94816737-94816759 CTGGGTTAGGAGGTGGGGGAAGG + Intronic
1057718380 9:97513659-97513681 CTGGGTACCCACTATGGGGAGGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1061878057 9:133554690-133554712 CGAGGTAACCAGGAGGAGGGAGG + Exonic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062039352 9:134396934-134396956 CTGGCTGCCCAGGAGGGGGCTGG + Intronic
1062332990 9:136052684-136052706 CCGGGCAACCAGGAGCCGGAAGG + Intronic
1062461085 9:136662857-136662879 CTGGGTAATCGGGATTGGGATGG - Intronic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1186457075 X:9718132-9718154 CTGGGTCACCAGCAGTGGGTAGG + Exonic
1186694325 X:12013637-12013659 CTGGATACCCAGGAGGCAGAGGG - Intergenic
1186707233 X:12154519-12154541 CTGGATAACCTGGAAGGGCAGGG - Intronic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1190007466 X:46754472-46754494 CTGATTAACCAGGAAGGAGATGG + Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190441193 X:50475960-50475982 GTAGGTAAGCAGGAGTGGGATGG + Intergenic
1190630570 X:52381480-52381502 GTGGGGAACCAGGAAGGGGCAGG + Intergenic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196343356 X:114622927-114622949 CTGGCTAACCATGAGAGGAAAGG + Intronic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1197889951 X:131259630-131259652 CTGGGGAACAAGGAGTGAGAGGG - Intergenic
1198927959 X:141820964-141820986 ATGGGTAACCCAGAGGGGAATGG + Intergenic
1200256211 X:154584680-154584702 CTGGGCGACCAGGACAGGGACGG + Intergenic
1200261558 X:154619723-154619745 CTGGGCGACCAGGACAGGGACGG - Intergenic
1200267540 X:154654020-154654042 CTGGGCGACCAGGACAGGGACGG - Intergenic