ID: 1152643350

View in Genome Browser
Species Human (GRCh38)
Location 17:81458108-81458130
Sequence AACCAGCCGGGTCTCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152643343_1152643350 6 Left 1152643343 17:81458079-81458101 CCAGGAGGGAGGACCGGCACAGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1152643350 17:81458108-81458130 AACCAGCCGGGTCTCTAGGATGG 0: 1
1: 0
2: 0
3: 5
4: 67
1152643344_1152643350 -7 Left 1152643344 17:81458092-81458114 CCGGCACAGTCAGCCCAACCAGC 0: 1
1: 0
2: 6
3: 33
4: 368
Right 1152643350 17:81458108-81458130 AACCAGCCGGGTCTCTAGGATGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152643350 Original CRISPR AACCAGCCGGGTCTCTAGGA TGG Intronic
901367393 1:8764566-8764588 AAACAGCCGGGGTTCAAGGAAGG + Intronic
912628223 1:111223643-111223665 AGCCAGCCGGGTCCCTACCAGGG + Intronic
915245206 1:154551567-154551589 AATCAGCTGTGTCTATAGGAGGG + Intronic
920295193 1:204951845-204951867 AAGGAGCTGGGTCTCTAGAATGG + Intronic
922748430 1:228059899-228059921 AAGGAGGCGGGGCTCTAGGATGG + Exonic
1065137169 10:22683166-22683188 AACCAGCAGCCTCTCTAGCAAGG + Intronic
1067161065 10:43825660-43825682 GACCGGCAGGGTCTCTGGGAGGG - Intergenic
1069740061 10:70681767-70681789 AGCCAGCTGGGTGTCTGGGAGGG - Intronic
1075955038 10:126516342-126516364 AACCAGCTGGGTCTTGGGGAGGG - Intronic
1076851559 10:133095855-133095877 AGCCGGCCGGGCCTCTGGGATGG - Intronic
1084269071 11:68019585-68019607 ACCCAGCCAGGGCTCTAGGAGGG - Intronic
1098058962 12:66539585-66539607 AACCAGTTGGTTCTCTGGGATGG + Intronic
1100181140 12:92087861-92087883 ATGCAGCCGGGTCTGTAAGAAGG + Intronic
1103654443 12:122459017-122459039 AATTAGCCGGGTGTCTTGGAGGG + Intergenic
1104986194 12:132598755-132598777 AGTCAGCCTGGTCGCTAGGAGGG - Intergenic
1107197823 13:37675397-37675419 AGTCAGCCGAGTCTCTTGGATGG - Intronic
1112299471 13:98217073-98217095 TACCCGCCGGGTCACGAGGAGGG - Intronic
1115344089 14:32323629-32323651 AACCAGGTGTGTCTCTTGGAGGG + Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1126060748 15:44779721-44779743 AACCAGACGGCTTTCTAGGAGGG - Intergenic
1140625890 16:76793987-76794009 AAACACCTGGGTCTCTAGGCAGG + Intergenic
1147140371 17:38457284-38457306 AACCAGCCAGGCCTCTGGGCTGG + Intronic
1152067367 17:78119089-78119111 AACCAGCCTGATCTCGGGGAGGG - Intronic
1152584117 17:81181529-81181551 AACCAGGCGGGGCTCACGGAGGG - Intergenic
1152643350 17:81458108-81458130 AACCAGCCGGGTCTCTAGGATGG + Intronic
1152803700 17:82344557-82344579 CACCAGGAGGGTCTCCAGGAGGG - Intergenic
1157295158 18:46437168-46437190 GACCAGGCGGGCCTCTAGGCAGG - Intronic
1157528111 18:48400528-48400550 AAGCAGCAGGGCCTCTAGGTGGG - Intronic
1159087042 18:63804785-63804807 AATCAACCAGGTGTCTAGGAAGG - Exonic
1161401685 19:4068429-4068451 AACCAGCCGGGTAGGTGGGAAGG + Intergenic
1161597320 19:5157253-5157275 AACCAGCAGGGGCCCTGGGAAGG - Intergenic
1163209256 19:15828610-15828632 AAGCTGCCGGGTCTCTTGGAGGG - Intergenic
1165562208 19:36689513-36689535 AAGCAGCAGGTTCTCTTGGAAGG - Intronic
1167107314 19:47437807-47437829 AACCAGGCTGGACTCCAGGAAGG + Intronic
1168316654 19:55487510-55487532 AACCAGACGGATCTGGAGGAAGG - Exonic
925288739 2:2732365-2732387 AGCAACTCGGGTCTCTAGGATGG + Intergenic
932707607 2:74038672-74038694 CACCAGCCAGGTCCCTAGGGAGG + Intronic
934664895 2:96163376-96163398 AACCTGAGGGGTCTCAAGGATGG - Intergenic
944001917 2:194850149-194850171 AAGCTGCTGGTTCTCTAGGATGG + Intergenic
1169171679 20:3470711-3470733 AGAGTGCCGGGTCTCTAGGAGGG + Intergenic
1169210885 20:3765743-3765765 AAGCAGCCAGGTCCCTAGGGAGG + Intronic
1170230303 20:14039230-14039252 AACCTTCATGGTCTCTAGGATGG - Intronic
1170443564 20:16402390-16402412 AACCAGTCAGGATTCTAGGACGG - Intronic
1170793862 20:19529724-19529746 ACCCAGCCAGGTACCTAGGATGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174827092 20:53778235-53778257 CACCTGCCAGGTCTCTAGGCTGG + Intergenic
1175990169 20:62784746-62784768 ACACAGCCTGGCCTCTAGGACGG + Intergenic
1177665904 21:24158953-24158975 ACCCAGCTGGGACTCTAAGAGGG - Intergenic
1179716196 21:43290060-43290082 AATCAGGCGGGTCTCCAGGGAGG - Intergenic
1179896999 21:44368802-44368824 ACTCAGCCTGGTCCCTAGGAAGG - Intronic
1184570877 22:45324245-45324267 GCCCACCCGGGTCTCTAGGTGGG - Intronic
951452977 3:22860202-22860224 ATCCAGCTGTGTGTCTAGGAAGG + Intergenic
955307123 3:57844861-57844883 AACCAGCCGGGTGTAGTGGAGGG - Intronic
969052475 4:4383101-4383123 AGCCAGCCAGATCTCCAGGATGG - Intronic
982559599 4:156913967-156913989 AACCAGCAGGGATTCTAGAAGGG - Intronic
985553997 5:547244-547266 AGCCCACTGGGTCTCTAGGAGGG - Intergenic
995631496 5:114138298-114138320 AAACAGCCTGAGCTCTAGGAGGG + Intergenic
997734446 5:136203069-136203091 AACCAGCCGGGCCTCTTTAAGGG + Intergenic
1003882602 6:10491828-10491850 AACCGGCTGGGTTTCTGGGAGGG + Intergenic
1008732199 6:54495755-54495777 TACCATCTGGGTCTCTTGGAAGG - Intergenic
1015636849 6:135285015-135285037 AATCAGCCGGGTCTCATGGCAGG - Exonic
1019337588 7:492628-492650 GAGCAGCAGGGGCTCTAGGAGGG + Intergenic
1019578501 7:1749002-1749024 CAGCAGCCGGGACTTTAGGAAGG - Intergenic
1023334473 7:39153850-39153872 AAACAGCCGGGTTGCTGGGAGGG + Intronic
1029968775 7:104768578-104768600 AACCAGCTGGCTATCTAGCAGGG - Intronic
1035043966 7:155952090-155952112 AACCAGCCAGGTCACTAGGCAGG - Intergenic
1043456407 8:80416542-80416564 AAGCAGCCGGGACTACAGGAGGG - Intergenic
1048704314 8:137134100-137134122 AACCTGCAGTGTCTCTAGGCAGG + Intergenic
1053411330 9:37917815-37917837 AGCCAGCGTGGTCTCTATGAGGG + Intronic
1062109019 9:134772042-134772064 ACCCAGCCGAGGCTCTAGGAAGG - Intronic
1187414739 X:19083428-19083450 ACCAAGCAGGGTCTCTAGAAGGG - Intronic
1192179551 X:68907940-68907962 AGCCAGCCGGGTCTCTCTGCAGG - Intergenic
1199766722 X:150946802-150946824 AACCAGCCTGGGCTCCAGGTGGG - Intergenic