ID: 1152644120

View in Genome Browser
Species Human (GRCh38)
Location 17:81460990-81461012
Sequence GGCAGCGGCCAGCAAGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 459}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152644107_1152644120 24 Left 1152644107 17:81460943-81460965 CCCTTGCTGAGCTGGTCCGCGGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 459
1152644108_1152644120 23 Left 1152644108 17:81460944-81460966 CCTTGCTGAGCTGGTCCGCGGTG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 459
1152644105_1152644120 25 Left 1152644105 17:81460942-81460964 CCCCTTGCTGAGCTGGTCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 459
1152644115_1152644120 -7 Left 1152644115 17:81460974-81460996 CCAAGCGGAAGGCGGTGGCAGCG 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 459
1152644110_1152644120 8 Left 1152644110 17:81460959-81460981 CCGCGGTGGCGCAGACCAAGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152644120 Original CRISPR GGCAGCGGCCAGCAAGGGGC CGG Exonic
900127418 1:1074661-1074683 GGCAGCAGTGAGCAAAGGGCAGG - Intergenic
900419448 1:2549390-2549412 GGCAGCGGCCACCCAGTGCCTGG + Intergenic
900425786 1:2577996-2578018 GGCAGCGGCCACCCAGTGCCTGG - Intergenic
900490175 1:2944097-2944119 GGCAGCAGCCAGCCTGGAGCAGG - Intergenic
900556929 1:3285246-3285268 GGCAGGGGCCTCCACGGGGCTGG - Intronic
900794125 1:4697816-4697838 TGCAGCGGCCACTAATGGGCTGG + Intronic
901003533 1:6160698-6160720 GGAAGCGGCCAGGATGGGGTGGG - Intronic
901693576 1:10990254-10990276 GGGACCAGCCAGCAAGGGGAGGG + Intergenic
902221479 1:14968618-14968640 CACAGCAGCCAGCACGGGGCGGG + Intronic
902350169 1:15848205-15848227 GGGAGGGGCCGGCAACGGGCCGG - Intronic
902534618 1:17112380-17112402 GCCAGATGCCAGCAAGGAGCAGG - Intronic
902990025 1:20180822-20180844 GGCAGCAGCCAGTAAGTTGCAGG + Intergenic
903172465 1:21562779-21562801 TGCAGGAGCCAGCAAGGGGTTGG - Intronic
903190250 1:21652103-21652125 GGCGGCGGCCGGGAAGGGGGTGG - Intronic
904009973 1:27383779-27383801 GGCAGGGGCCAGCTAGGGCCCGG - Intergenic
904038388 1:27570859-27570881 GGCAGGGGCCTGGAGGGGGCTGG - Intronic
904586567 1:31584124-31584146 GGCAGCGGGGAGGCAGGGGCTGG + Intronic
905127409 1:35725467-35725489 GGCAGCTGCTAGGAAGGGGGTGG - Intronic
905172445 1:36117081-36117103 GGCAGAGGCAAGCAAGCAGCTGG - Intronic
905971378 1:42144916-42144938 GGCAGATGTCAGCAAAGGGCTGG + Intergenic
906061599 1:42952698-42952720 GGCAGCCCCCACCTAGGGGCAGG + Intronic
906063165 1:42961399-42961421 GAAAGTGGCCAGCATGGGGCTGG - Intergenic
906703034 1:47873491-47873513 GGCAGCAGACAGCATGTGGCTGG + Intronic
906949602 1:50323552-50323574 TGCCGTAGCCAGCAAGGGGCTGG - Intergenic
907341576 1:53739263-53739285 GGCCGCGGCCAGCCAGTGGCTGG - Intergenic
908960881 1:69695675-69695697 GGCACAGGGCAGCAAGGGCCTGG - Intronic
912473514 1:109922003-109922025 GGCAGGGGCCAGCAAGTGTGTGG + Intronic
912948422 1:114104042-114104064 GGAAGAGGCCACAAAGGGGCTGG - Intronic
913143897 1:115970136-115970158 GACAGAGACCAGGAAGGGGCTGG - Intergenic
914995270 1:152538010-152538032 GGCAGTGGTCAGCAAGGTGGGGG - Intronic
914998545 1:152565967-152565989 GGCAGTGGTCAGCAAGGCGGGGG - Exonic
914999897 1:152579695-152579717 GGCAGTGGTCAGCAAGGCGGGGG - Exonic
915001820 1:152600957-152600979 GGCAGTGGTCAGCAAGGCGGGGG + Exonic
916069081 1:161159636-161159658 GGGAGAGGCCAGCCAGGGCCAGG - Exonic
916606773 1:166350724-166350746 AGCAGCCGCCAGAAAGGGGGTGG - Intergenic
916651546 1:166839254-166839276 GGAAGCGGCCTGCATCGGGCGGG + Intergenic
920962474 1:210675800-210675822 GACAGAGGCCAGAGAGGGGCAGG + Exonic
922233359 1:223704992-223705014 GGGAGTTGCCAGGAAGGGGCTGG - Intronic
922335542 1:224616157-224616179 GGCAGCGGCCACCAAGCGCCCGG + Intronic
922478895 1:225924859-225924881 GGCAAGTGACAGCAAGGGGCTGG - Intergenic
1062949295 10:1485515-1485537 GGCAGCGGCCAGAGACTGGCGGG - Intronic
1063102612 10:2963538-2963560 GTCAGCAGCCAGCAAAGGCCTGG + Intergenic
1063121298 10:3106875-3106897 GGCAGGGGCGAGGAGGGGGCAGG - Intronic
1063237639 10:4135004-4135026 GGCACCAGCAAGCAAGAGGCTGG + Intergenic
1064011849 10:11742282-11742304 GGGAGCGGCGAGCCGGGGGCGGG + Intergenic
1065585337 10:27212051-27212073 AACAGAGGCCAGCAAGGGGCCGG + Intronic
1065870873 10:29955534-29955556 GGCAACAGCCAGCAGGGAGCTGG + Intergenic
1067080205 10:43208453-43208475 GTCAGCAGCCAGAGAGGGGCTGG + Intronic
1069651536 10:70053235-70053257 TCCTGCGGCCAGCGAGGGGCCGG + Intronic
1069774668 10:70919444-70919466 GGGAGCGCCCAGAAAGAGGCCGG - Intergenic
1069776495 10:70930232-70930254 GGCTGGGACCAGCACGGGGCTGG - Intergenic
1069830027 10:71277334-71277356 GCCTGAGGCCAGCAAGGGGCTGG + Intronic
1070503380 10:77092016-77092038 CGCAGCGGCCACCAAGGTGAGGG + Intronic
1070642725 10:78180973-78180995 GGGGGCAGCCAGCAAGGGACGGG - Intergenic
1072151847 10:92690234-92690256 GGCAGCGGCCAGCGCGGCGGCGG - Exonic
1073146275 10:101284104-101284126 GGGAGCGGGGAGCGAGGGGCGGG + Intergenic
1073578067 10:104641513-104641535 GGCAGTGGCCAGCCAGTGGCCGG + Exonic
1074942246 10:118247011-118247033 GGAAGCACCCAGCAAGGGACCGG - Intergenic
1075105610 10:119538333-119538355 TGCAGAGGCCACTAAGGGGCAGG - Intronic
1076554367 10:131311989-131312011 GCCAGAGGCCACCAGGGGGCCGG - Intergenic
1076595139 10:131620491-131620513 GGCAGCAGCCAGAAAGGGCCTGG + Intergenic
1076671791 10:132124892-132124914 GACAGCGGCAAGAAAGAGGCTGG + Intronic
1076747890 10:132523428-132523450 ACCAGGGGCCCGCAAGGGGCAGG - Intergenic
1076858649 10:133129385-133129407 GGCTGGGGCCACCAAAGGGCAGG - Exonic
1076889786 10:133277763-133277785 GGGCAGGGCCAGCAAGGGGCTGG + Intergenic
1077062665 11:624765-624787 GGCGGCGGGGAGCCAGGGGCTGG - Intronic
1077095062 11:795735-795757 GGAAGGGGCGGGCAAGGGGCTGG - Intronic
1077144779 11:1040020-1040042 GGCAGGGGCAGGGAAGGGGCTGG - Intergenic
1077145132 11:1041220-1041242 GGCAGCGGACAGCACAGGGCTGG - Intergenic
1077300503 11:1844387-1844409 GGCTGTGGCCAGGAAGGGGTTGG + Intergenic
1077341158 11:2027007-2027029 GGCAGCGGGCAGCACGGCGGGGG - Intergenic
1077423889 11:2465577-2465599 GAGAGGGGCCAGCACGGGGCAGG - Intronic
1080902636 11:36510273-36510295 GGCTGCGGGGAGCGAGGGGCAGG + Intergenic
1083048233 11:59755311-59755333 GGGCGCGGCCAGGTAGGGGCGGG + Exonic
1083571786 11:63765138-63765160 GGCCGGGGGCAGCAGGGGGCTGG - Exonic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083680516 11:64349593-64349615 GGCGGCGACCAGCAAGGAGGAGG + Exonic
1083811371 11:65108616-65108638 GGCAGCGGCCAGCAGGGCCCCGG - Exonic
1083896990 11:65624961-65624983 GGCAGCAGCCAGCAGGCTGCGGG - Exonic
1083897495 11:65627387-65627409 GGCAGCTGTGGGCAAGGGGCAGG - Exonic
1083970356 11:66070535-66070557 GGCAGCGGCCAGCGGGGATCCGG + Exonic
1084209788 11:67615608-67615630 GCCAGGGGCCAGCAAGGTGAGGG - Intergenic
1084338321 11:68475522-68475544 GGCAGCGGCCGGGCGGGGGCTGG + Intronic
1084445436 11:69200788-69200810 GGCACCGGTCAGCACGCGGCAGG + Intergenic
1084458913 11:69285449-69285471 GGGAACGGCCAGCGAGGGGCAGG - Intergenic
1084483582 11:69435488-69435510 GTCAGGGGCCAGCTCGGGGCAGG + Intergenic
1084526962 11:69703814-69703836 GGCCACGGCCAGCCAGAGGCCGG + Exonic
1085035655 11:73298280-73298302 GGCAGAGCCCAGCACGAGGCTGG - Exonic
1085296686 11:75435363-75435385 GGCTGCGGCTGACAAGGGGCTGG + Exonic
1088624649 11:111721035-111721057 GGCAGCTGCTAGCAAGGTCCTGG - Exonic
1089285785 11:117407184-117407206 GTCAGCAGAGAGCAAGGGGCTGG + Intronic
1202824143 11_KI270721v1_random:82196-82218 GGCAGCGGGCAGCACGGCGGGGG - Intergenic
1092108910 12:5945319-5945341 GGCGGCAGCCGGCGAGGGGCGGG - Intronic
1092169301 12:6363392-6363414 GCCAGGGGCCGGCGAGGGGCGGG + Intronic
1092237604 12:6819812-6819834 AGAAGCGGGCAGCATGGGGCAGG - Exonic
1092259789 12:6946678-6946700 GGCAGAGGGCCGCAGGGGGCGGG - Intronic
1092263368 12:6963807-6963829 GGCTGCAGCCAGCTAAGGGCTGG - Intergenic
1096181880 12:49555732-49555754 GCCAGGGGACAGCAGGGGGCTGG - Exonic
1096256221 12:50063814-50063836 GGCAGTGCCCAGCAAGAGCCAGG + Intronic
1099289728 12:80761833-80761855 GGCAGGGGCCAGGTGGGGGCTGG + Intergenic
1100565490 12:95790461-95790483 GGCAGCTGGGAGCCAGGGGCCGG + Exonic
1103056347 12:117824235-117824257 GCCAGAGGCTAGGAAGGGGCAGG + Intronic
1103308867 12:119989141-119989163 GTCAGGCGCCGGCAAGGGGCGGG + Intergenic
1103761902 12:123256385-123256407 GGCAGAGGCAGGAAAGGGGCTGG + Intronic
1104667921 12:130660630-130660652 TGCAGCCTCCAGCATGGGGCAGG - Intronic
1104683823 12:130771410-130771432 GGCAGCGGCCAGAATGTGTCGGG - Intergenic
1104946487 12:132417024-132417046 GGCTGCCGCCAGCAAGGGGGTGG - Intergenic
1104975936 12:132552004-132552026 AGCACCGGCCTGGAAGGGGCAGG + Intronic
1105408362 13:20150250-20150272 GGCAGCTGGCGGCATGGGGCTGG + Intronic
1106249463 13:27972539-27972561 GGCAGGGGCCACAAAGGGGGTGG + Intergenic
1106960115 13:34988511-34988533 GGCAGCAGCCTGGCAGGGGCAGG - Intronic
1110037937 13:70712538-70712560 GCCAACAGCCAGCAAGGAGCTGG - Intergenic
1110374183 13:74773898-74773920 GGCAGAGCCCAGCAAGTGGTAGG - Intergenic
1112033142 13:95475206-95475228 GGGAGCAGGCAGCAGGGGGCAGG - Intronic
1112252908 13:97800477-97800499 GGCTTCGGCCAGCAGAGGGCAGG - Intergenic
1112337869 13:98529311-98529333 GGCAGTGACCTGGAAGGGGCTGG - Intronic
1112770786 13:102792721-102792743 GACAGCAGCCAGGAAGAGGCAGG + Intronic
1113924323 13:113931923-113931945 GGCAGGGGCCAGCCTGGGGGAGG - Intergenic
1114449049 14:22812907-22812929 GGCAGCAGCCAGCAGGCGGCTGG + Exonic
1114455518 14:22851036-22851058 GGAGGCCGCCTGCAAGGGGCTGG + Intergenic
1114573231 14:23690267-23690289 GGCAGCAGCCTGGAAGGGGGAGG - Intergenic
1115985901 14:39103266-39103288 GGAAGGGGGCAGGAAGGGGCGGG + Exonic
1116872768 14:50083866-50083888 GGCCACGGCCACCAAGGGGCTGG + Exonic
1117278995 14:54219496-54219518 GGCTGCGGAGAGCAAGGGTCAGG - Intergenic
1117285854 14:54285239-54285261 GGCAGAGCACAGCAAGTGGCAGG + Intergenic
1118514001 14:66507611-66507633 GCCAGCGGCTAGCACGAGGCAGG + Exonic
1119122028 14:72088610-72088632 GGCAGAGGACAGAAAGTGGCTGG - Intronic
1119322705 14:73741086-73741108 GGCAGGGGTCAGGCAGGGGCGGG - Intronic
1119401355 14:74364811-74364833 GAAAGCGGACAGCCAGGGGCAGG - Intergenic
1119443873 14:74647847-74647869 GGCAGCAGCCAGGAAGAGGGAGG - Intergenic
1119474674 14:74920229-74920251 GACAGCCGCCAGCAAGGCGGTGG - Intronic
1119722645 14:76901553-76901575 GGCAGGGGCCAGGAGGAGGCAGG + Intergenic
1120970694 14:90204664-90204686 GGCAGCTGACAGCAACAGGCTGG - Intergenic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121755727 14:96400549-96400571 GGCAGAGCCCAGGAAGGGGCAGG - Intronic
1122183600 14:99972287-99972309 GGCAGTGTTCTGCAAGGGGCAGG + Intronic
1122273715 14:100580432-100580454 GGCAGCGGGGAGCACGGGGCGGG - Intronic
1122602691 14:102929457-102929479 GGCAGCGGCCGCCCAGGGGCTGG - Exonic
1122917432 14:104865524-104865546 GGCCGCGGCCAGCGCTGGGCCGG - Intronic
1122987388 14:105218807-105218829 GCCTGTGGCCAGCACGGGGCAGG + Intronic
1123098334 14:105776863-105776885 GGAAGCGTCCAGCAAGGAACAGG + Intergenic
1123967985 15:25477973-25477995 GGCAGCAGACAGCAAGGAACAGG - Intergenic
1124017040 15:25886301-25886323 GGCAGAAGCCAGGAAGGGACTGG + Intergenic
1125676931 15:41507140-41507162 GGCAGAGGCCAGGACTGGGCCGG + Exonic
1125894060 15:43287332-43287354 AGCAGTGGTCAGCCAGGGGCGGG - Exonic
1126422538 15:48490007-48490029 GGTGGCGGCCAGCAATAGGCAGG + Exonic
1126509364 15:49450619-49450641 GGCTGCAGCCAGCAAGAGTCTGG + Intronic
1126739082 15:51759880-51759902 GCCTGAGGCCAGCCAGGGGCAGG + Intronic
1126852605 15:52806187-52806209 GGACTCTGCCAGCAAGGGGCGGG - Intergenic
1127895836 15:63298070-63298092 TGCAGTGGCCAGCATGGGCCAGG - Intronic
1128081989 15:64862274-64862296 GGCAGGGGCCAGGAAGGAGGTGG + Intronic
1128499558 15:68218347-68218369 GGCAACTGCCAGCAAGTGGGGGG - Intronic
1128666760 15:69543891-69543913 TGCTGGGGCCAGCAAGAGGCTGG + Intergenic
1129116479 15:73368030-73368052 GGCAGCGGACAGCGAAGGGCCGG - Exonic
1129410533 15:75348182-75348204 GGCAGGGGCCAGGACGAGGCGGG - Intronic
1129757154 15:78105416-78105438 GGCACTGTCCAGCATGGGGCTGG - Intronic
1130415076 15:83685977-83685999 GCTAGCTGCCAGCAAGAGGCTGG - Intronic
1130540366 15:84817410-84817432 GGCAGCGGCGAGTGCGGGGCCGG + Exonic
1131024648 15:89129691-89129713 GCCACTGGCCAGCAGGGGGCAGG - Intronic
1131151212 15:90048521-90048543 GGTCGGGGCCAGCACGGGGCAGG + Intronic
1132553749 16:564010-564032 GGCCGGGGGCAGCAGGGGGCTGG - Exonic
1132582315 16:690512-690534 GGCAGAGGCCAGGAGGGGCCCGG + Intronic
1132599891 16:768739-768761 GGCTGGGGCCAGCAAGGGAGTGG - Exonic
1132717617 16:1299831-1299853 GTCAACGGCCAGCAAGGTTCCGG + Intergenic
1133002052 16:2856719-2856741 GGCACAGGTCAGAAAGGGGCTGG - Intronic
1133051258 16:3118726-3118748 GGCAGCCGCCAGGCAGGGGGCGG + Intronic
1133620266 16:7519327-7519349 GGCAGGGGCTAGAAAGAGGCAGG + Intronic
1134081143 16:11325954-11325976 GCCTGCGGCCAGCTGGGGGCCGG - Intronic
1135725973 16:24854124-24854146 GGCAGAGGTCTGGAAGGGGCGGG + Intronic
1136248528 16:28989088-28989110 GGCAGTGGCTGGCAGGGGGCAGG + Intronic
1136318027 16:29465581-29465603 AGCAGCTGCGAGGAAGGGGCTGG - Intronic
1136428890 16:30185885-30185907 GGCAGCAGCCAGCCAGCGGAGGG - Intronic
1136432602 16:30204930-30204952 AGCAGCTGCGAGGAAGGGGCTGG - Intronic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1136483070 16:30555013-30555035 GGCAGTGGGGAGCAAGGTGCTGG + Exonic
1138584795 16:57962751-57962773 GGCAGAGGCTCCCAAGGGGCAGG + Intronic
1139370186 16:66462469-66462491 TGCAGCGCCCAGCCAGGTGCTGG - Intronic
1139377928 16:66512145-66512167 GGAAGCAGGCAGCAGGGGGCAGG + Intronic
1139593679 16:67946561-67946583 GGTGGTGGCCAGCAAGGTGCGGG - Exonic
1140126929 16:72125484-72125506 GGCAGAGGACAGGAAGGGACTGG - Intronic
1140205151 16:72927595-72927617 CCCAGCGGCCCGCGAGGGGCTGG + Intronic
1140974367 16:80044882-80044904 GGCAGGGGCCAGCTAGGGGATGG + Intergenic
1141474161 16:84260969-84260991 GGACGCGGTCTGCAAGGGGCTGG - Intergenic
1141495366 16:84406144-84406166 GGCAGCAGCTAGCAAGGGAAGGG - Intronic
1141617894 16:85220616-85220638 AGCAGCGGGCAGCAGCGGGCAGG - Intergenic
1141764305 16:86048480-86048502 GGCAGAGGCCAGGCCGGGGCAGG - Intergenic
1141804789 16:86335550-86335572 TGCAGGGGCCATCCAGGGGCAGG - Intergenic
1141904969 16:87018604-87018626 AGGAGCTGCCAGCAAGGGGAAGG - Intergenic
1142249717 16:88985790-88985812 GGCGACAGCCAGGAAGGGGCTGG - Intergenic
1142250479 16:88989623-88989645 GGCAGCAGCCAGCGAGGGGCCGG - Intergenic
1142282581 16:89156362-89156384 GGGGCCGCCCAGCAAGGGGCAGG - Intergenic
1142406103 16:89891152-89891174 GGCAGATGCCAGGAGGGGGCAGG - Intronic
1142417010 16:89948725-89948747 GGCAGCAGCGAGCGCGGGGCTGG + Intronic
1142483331 17:231641-231663 GGCAGAGGCTAGCATGGGCCAGG + Intronic
1143558263 17:7676088-7676110 GACAGGGGCCAGGAGGGGGCTGG + Exonic
1143644241 17:8219678-8219700 GGCAGGGGCAAGAAAGGGGAAGG + Intergenic
1144490590 17:15704901-15704923 GGCTGCGGCCGGCCGGGGGCGGG + Intronic
1145241343 17:21242483-21242505 GGCCAAGGCCAGCAAGGGGCGGG + Exonic
1146182755 17:30708373-30708395 GGCAGCGACGTGCAAGGGGGAGG - Intergenic
1146400156 17:32495329-32495351 GGCAGGGACCAGCCAGGAGCAGG - Intronic
1146644307 17:34566957-34566979 GGCACCTGCAAGGAAGGGGCTGG - Intergenic
1147161417 17:38571503-38571525 GGCAGAGGGCAGGAAGGGCCAGG + Intronic
1147202219 17:38810369-38810391 GGCAGCTTCCAGCACAGGGCAGG + Intronic
1147440268 17:40443463-40443485 GGCGGCGGGCGGCGAGGGGCAGG - Exonic
1147898845 17:43770359-43770381 GTCAGAAGCCTGCAAGGGGCTGG + Intronic
1148178117 17:45584995-45585017 GAAAGCGGCCGGGAAGGGGCGGG + Intergenic
1148760600 17:49997913-49997935 GACAGCGGGAAGCATGGGGCAGG + Intergenic
1148876904 17:50693561-50693583 GACAGAGGCAAGCAAGGGACTGG - Exonic
1150408013 17:64919285-64919307 GAAAGCGGCCGGGAAGGGGCGGG + Intronic
1150655139 17:67034243-67034265 GGGAGAGGCCAGGAAGGAGCTGG - Intergenic
1150816405 17:68395523-68395545 GGTTGCCGCCAGCAAGTGGCTGG + Intronic
1151539521 17:74758035-74758057 GGCATCAGCCAGGGAGGGGCTGG + Intronic
1151881413 17:76897430-76897452 AGGAGCAGCCAGGAAGGGGCAGG - Intronic
1152304861 17:79514565-79514587 GGCAGTGGCCACAAAAGGGCAGG - Intronic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152748435 17:82051713-82051735 GGCCGCGGCCAGCGCGAGGCAGG + Exonic
1152786497 17:82250649-82250671 TGCAGGGGCCAGGGAGGGGCGGG - Intronic
1152885408 17:82846392-82846414 AGCAGCGGGCAGCAGAGGGCTGG - Intronic
1152919136 17:83057079-83057101 GGCAGGGGCCAGGAAGGAGCGGG + Intergenic
1154191962 18:12237377-12237399 GCCCGCGGCCACCAGGGGGCAGG - Intergenic
1158306757 18:56114768-56114790 GTAAGCAGCCAGCAAGAGGCAGG - Intergenic
1158454366 18:57593446-57593468 AGCAGCGGGAGGCAAGGGGCAGG + Intergenic
1158934743 18:62354348-62354370 GTCAGTGGCCAGGGAGGGGCAGG - Intronic
1160033205 18:75279776-75279798 GGCAGGGCCCAGCCCGGGGCAGG - Intronic
1160510377 18:79450149-79450171 GGCGGCAGCCAGCACAGGGCTGG - Intronic
1160724239 19:610596-610618 GGCAGCGGGAAGCAAGGCGGGGG - Intronic
1160736562 19:665336-665358 GGGAGGGGTCAGCGAGGGGCAGG - Intergenic
1160856318 19:1219426-1219448 GGCAGGGGCCAGGGTGGGGCGGG + Intronic
1160856418 19:1219972-1219994 GGCGGCTGCCAGCGATGGGCTGG - Intronic
1160910070 19:1470131-1470153 GGCTGCGACCACCATGGGGCTGG - Exonic
1160994411 19:1876040-1876062 GAGAGCGGCCGGAAAGGGGCAGG + Intergenic
1161415593 19:4145042-4145064 GCCAGGGGCCAGCCAGAGGCTGG - Intergenic
1161566415 19:5005264-5005286 GGCAGCTGGCAAGAAGGGGCAGG + Intronic
1162130938 19:8525900-8525922 GGCAACAGCAAGGAAGGGGCGGG - Intronic
1162301847 19:9849026-9849048 GGCAGAGGCCAGGATGAGGCAGG - Intronic
1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG + Exonic
1162417210 19:10545021-10545043 GGCAGCCCCCAGGAAGGGGCGGG - Exonic
1162554124 19:11375813-11375835 GGCTGCAGCCAGCACTGGGCAGG - Exonic
1162918343 19:13886012-13886034 GGGCCCGGCCAGCAAGGGCCCGG + Exonic
1162935109 19:13978296-13978318 GGCTGGGGCCAGCAAGGGTGGGG + Intronic
1162958271 19:14111983-14112005 ACCAGCGGACAGCCAGGGGCTGG - Intronic
1163305936 19:16478910-16478932 GCCAGAGGCCAGCAAGGGTCTGG - Intergenic
1163441974 19:17326864-17326886 GGCAGCATCCAGCACGAGGCTGG - Intronic
1163591162 19:18194886-18194908 CGGAGCGGCCATCAGGGGGCGGG - Intronic
1163606998 19:18281082-18281104 GGTGGCGGCCAGCGAGGAGCAGG - Exonic
1164721806 19:30438067-30438089 GCCAGGGGCCAGCAGAGGGCAGG - Intronic
1165227425 19:34364989-34365011 GGCAGAGGCCAGCAAAGCGGCGG + Exonic
1165407266 19:35638452-35638474 GGCAGAGGCCAGCTTGGAGCTGG - Intergenic
1165819592 19:38666093-38666115 GGAAGAGGCCTGGAAGGGGCAGG - Intronic
1165926322 19:39328272-39328294 GGCTTGGGCCAGCAGGGGGCGGG - Intergenic
1166384995 19:42375890-42375912 AGCAGGGGCCAGCAGTGGGCCGG + Exonic
1167008239 19:46788798-46788820 GGGCGGGGCCAGGAAGGGGCGGG + Intergenic
1167072346 19:47228261-47228283 GGCAGCGGGCAGCAGGGTGGGGG + Exonic
1167251339 19:48399881-48399903 GGGCGGGGCCAGCGAGGGGCGGG + Intronic
1167413925 19:49360785-49360807 GACAGAGACCAGCAAGGGGGGGG + Intronic
1167685444 19:50953009-50953031 GGCAGTGGCCAGGAAGGCACAGG - Exonic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
1168301515 19:55407590-55407612 GGCTGCGGCCGGCCGGGGGCGGG + Exonic
1168323799 19:55526504-55526526 GGCAGCTGCCAAGCAGGGGCGGG + Intergenic
925466392 2:4110456-4110478 GGCAGGGGGCAGCAGGTGGCTGG - Intergenic
926228525 2:10985443-10985465 GGAAGCAGCCAGCAGGGGACTGG + Intergenic
927193963 2:20535118-20535140 GGCAGAGGCCCGCATGGTGCGGG + Intergenic
927196624 2:20552143-20552165 GGCAGAGCCCAGCAAGGGTGGGG - Intergenic
927213215 2:20651156-20651178 GGCCGCTGCCACCAGGGGGCAGG - Intergenic
927301349 2:21519571-21519593 GGCAGCAGCAAGCCAGGGGGAGG + Intergenic
927574385 2:24189488-24189510 GGAAAGGGCCAGTAAGGGGCTGG - Intronic
927686494 2:25174852-25174874 GGCAGAGCCCAACATGGGGCAGG + Intergenic
927717020 2:25359660-25359682 GGGAGGGGACAGCAAGGGGAGGG - Intergenic
929002589 2:37362806-37362828 GGCAGAGGTGAGGAAGGGGCTGG + Intronic
929995743 2:46825391-46825413 GACAGCGGGCAGGAGGGGGCTGG + Intronic
930921846 2:56765386-56765408 GGCAGGGGGCACCAAGGAGCAGG - Intergenic
930992147 2:57669073-57669095 GGAAGTGGCAAGCAAGGGGAGGG + Intergenic
931250091 2:60522581-60522603 GGCAAAGGACTGCAAGGGGCAGG - Intronic
932422761 2:71611390-71611412 GGCTGGGGCCAGGAAGGGGAAGG - Intronic
933234005 2:79844179-79844201 GGAAGCAGCCTGCAAGAGGCAGG + Intronic
933771640 2:85748371-85748393 GGCTGCAGCCAGCTAGAGGCTGG + Intergenic
934464341 2:94245925-94245947 GCTAGAGGCCAGCAAGGGGAGGG - Intergenic
937244135 2:120481732-120481754 GGCAGCCCCCAGCCAGGGCCAGG + Intergenic
937279297 2:120706269-120706291 GGCAGCTGGCAGCAAGGAGAGGG - Intergenic
937280023 2:120711331-120711353 GGCCTAGGCCAGCATGGGGCGGG + Intergenic
938407468 2:131040456-131040478 CGCAGCGCCCAGGTAGGGGCCGG - Intronic
939035832 2:137130108-137130130 GGAAGGAGACAGCAAGGGGCTGG + Intronic
939039626 2:137172497-137172519 GGCAGATCCCAGCAAGGGGATGG + Intronic
941917888 2:170823892-170823914 AGCAGGGGACAGCAGGGGGCAGG - Intronic
945245163 2:207711362-207711384 GGCAGCTGCCAGGCGGGGGCGGG + Intergenic
946127253 2:217573862-217573884 GACAGCTGCAGGCAAGGGGCTGG + Intronic
946255004 2:218435703-218435725 GGCAGCTCAAAGCAAGGGGCAGG + Intronic
946374431 2:219299533-219299555 GGGTGGGGCCAGCAACGGGCTGG + Intronic
947638588 2:231693447-231693469 AGCAGGGGCCAGCAAGGCCCTGG + Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
949045639 2:241871596-241871618 GGCAGGGGGCAGCGAGGCGCTGG + Intronic
1169081599 20:2800651-2800673 GGCGGGGGGCAGGAAGGGGCGGG - Intergenic
1169914336 20:10672055-10672077 GGAAGGGGCCAGCAGCGGGCGGG + Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1170796520 20:19552190-19552212 GGCATCAGCCAGAAATGGGCAGG + Intronic
1171217396 20:23362265-23362287 GGCGGCGGGCGGCGAGGGGCCGG - Intronic
1171480591 20:25453147-25453169 GGGAGCTGTCAGCAAGGAGCAGG - Exonic
1171495770 20:25554105-25554127 GGCAACGTTCAGGAAGGGGCAGG + Intronic
1171769785 20:29313675-29313697 GGCAAAGGCCAGCCAGGGGAGGG + Intergenic
1172913707 20:38428718-38428740 AGCAGCGTCCAGCAAGCAGCTGG + Intergenic
1173197348 20:40926589-40926611 GGCAGCGGCCAGGAAATGGCAGG - Intergenic
1173246305 20:41340166-41340188 GACACTGGCCAGCAGGGGGCAGG - Intergenic
1173261777 20:41442789-41442811 GGCAGCACCCAGGCAGGGGCAGG + Intronic
1173660047 20:44727115-44727137 GGCAGGGGACACCAGGGGGCAGG - Exonic
1173850785 20:46216491-46216513 GGCAGGGGCCAGTGAGGGGTTGG + Intronic
1173946108 20:46952196-46952218 GGCAGAGGCCTGAGAGGGGCAGG + Intronic
1174194231 20:48761663-48761685 CGCAGCCCCCATCAAGGGGCTGG + Intronic
1174667869 20:52277107-52277129 GGTAGCTGCCATCAAGGGGAAGG - Intergenic
1175230825 20:57472088-57472110 GGCAGGGGACAGCAAGGGCCTGG - Intergenic
1175247248 20:57589605-57589627 GGCAGTGGGCAGCAAGAAGCTGG - Intergenic
1175264366 20:57693511-57693533 GGTGGCGGCCAGCAGGTGGCAGG + Intronic
1175312930 20:58024371-58024393 GGCTGAGGGCAGCAGGGGGCTGG + Intergenic
1175371600 20:58496340-58496362 GGCAGGTGCCAGCCTGGGGCAGG + Intronic
1175491189 20:59382074-59382096 GGCACCTGCCAGGAAGAGGCAGG - Intergenic
1175584334 20:60126065-60126087 TGCAGGGGCCAGGAAGGTGCAGG + Intergenic
1175864006 20:62164974-62164996 GGCCTCAGCCAGCAAGGGGCAGG + Intronic
1175887784 20:62302374-62302396 GGCAGGGGTCAGGAAGGGGTGGG - Intronic
1175922252 20:62455736-62455758 GGCACTGGCCAGCATGAGGCCGG - Intergenic
1176080784 20:63272306-63272328 GGCAGTGGGCAGCAGGGGACCGG - Intronic
1176221118 20:63969772-63969794 GGCTGCGGCCAGAATGGGTCCGG + Intronic
1178482524 21:32991885-32991907 GGCAGAGGCCCGGGAGGGGCTGG + Intergenic
1178507247 21:33171929-33171951 GGCAGCGGCCTCCTTGGGGCAGG - Intergenic
1179898650 21:44377551-44377573 GGCTGGAGCCAGCAGGGGGCAGG + Intronic
1180064317 21:45405099-45405121 GGCAGGGGCCGGGCAGGGGCCGG - Intergenic
1180705216 22:17805324-17805346 GGCATCGGCCAAGGAGGGGCAGG + Intronic
1180763118 22:18223734-18223756 GGGAGAAGCCCGCAAGGGGCAGG - Intergenic
1180772527 22:18400813-18400835 GGGAGAAGCCCGCAAGGGGCAGG + Intergenic
1180803907 22:18650429-18650451 GGGAGAAGCCCGCAAGGGGCAGG + Intergenic
1180806856 22:18719020-18719042 GGGAGAAGCCCGCAAGGGGCAGG - Intergenic
1180854640 22:19038264-19038286 GGGAGCTCCCAGCCAGGGGCAGG + Exonic
1181217811 22:21344830-21344852 GGGAGAAGCCCGCAAGGGGCAGG - Intergenic
1181963864 22:26643024-26643046 GTCAGCAGCCACCAGGGGGCTGG + Intergenic
1182440951 22:30363535-30363557 GCCTGAGGCCAGGAAGGGGCAGG + Intronic
1182676418 22:32043012-32043034 GGGAGGGGCCAGCCAGGGGGTGG - Exonic
1182725955 22:32445797-32445819 GGCAGTGGCTAGTTAGGGGCTGG - Intronic
1182760363 22:32717617-32717639 GGCTGGGGCCAGGAAGCGGCTGG + Intronic
1182797416 22:33000872-33000894 AGGAGCGGCCAGCAGGTGGCAGG - Intronic
1183334807 22:37240478-37240500 CGCAGGGGCCAGCATGTGGCAGG + Intronic
1183712292 22:39512257-39512279 GCCAGTGGCCAGGAAGGGCCAGG + Exonic
1183935250 22:41258200-41258222 GGCTGCCGCCAGCACAGGGCAGG + Intronic
1183945083 22:41320855-41320877 GGGAGGAGCCAGGAAGGGGCTGG + Intronic
1184101200 22:42342586-42342608 GGCAGGGGCCTGCCAAGGGCCGG + Intronic
1184387734 22:44185924-44185946 GGCAGCGGCCTCCACGGGGCGGG + Intronic
1184520333 22:44990076-44990098 GGCAGAGGCCTACTAGGGGCTGG + Intronic
1184754520 22:46508442-46508464 GCGAGGGGACAGCAAGGGGCGGG - Intronic
1184761828 22:46549249-46549271 GGCAGAGTCCAGCACAGGGCTGG - Intergenic
1185070086 22:48651385-48651407 GGCTGTGCCCAGGAAGGGGCAGG + Intronic
1203234365 22_KI270731v1_random:141801-141823 GGGAGAAGCCCGCAAGGGGCAGG + Intergenic
950532900 3:13563357-13563379 GACACCTGCCAGCAAAGGGCAGG - Intronic
950556428 3:13698863-13698885 GGCAGCGGCTGGCATGGGGTGGG - Intergenic
950639267 3:14337810-14337832 GACAGCAGCCAGCACAGGGCAGG + Intergenic
952706141 3:36380232-36380254 GGCAGCGCCCTGGAAAGGGCTGG - Intergenic
952906017 3:38139535-38139557 GGCAGATGTGAGCAAGGGGCTGG - Intronic
954446007 3:50547271-50547293 GGCAAGGCCCAGCCAGGGGCAGG + Intergenic
954609793 3:51938203-51938225 GGCTGTGGGCAGGAAGGGGCTGG + Exonic
954683869 3:52360111-52360133 AGCAGCTGCCAGGAAGGGGCAGG + Intronic
955045419 3:55354940-55354962 GGCAGCAGGCAGGAAGGGGAAGG - Intergenic
955386664 3:58486266-58486288 AGCAGGAGCCAGCAGGGGGCTGG + Intergenic
955478460 3:59364204-59364226 GGCAGAGGCCAGAAAGGTCCTGG + Intergenic
959673398 3:109005675-109005697 AGTAGCAGCTAGCAAGGGGCAGG - Intronic
960854123 3:122085690-122085712 GGCAGCAGCCAGTAATGGGGTGG + Intronic
960854218 3:122086387-122086409 GGCAGCAGCCAGTAATGGGGTGG - Intronic
961202515 3:125055944-125055966 GGCAGCGGGCAGCGGGCGGCGGG + Exonic
961580242 3:127875030-127875052 GGCAGAGGGCAGCAGGGGCCTGG - Intergenic
961692671 3:128681187-128681209 GGACAGGGCCAGCAAGGGGCGGG - Intergenic
961715393 3:128853988-128854010 GGCAGAGGCCACCACTGGGCAGG - Intergenic
962407583 3:135113149-135113171 GGCGGGGGCCAGCATGGGGCGGG - Intronic
962902180 3:139771198-139771220 TGCAGTACCCAGCAAGGGGCTGG + Intergenic
963346161 3:144098844-144098866 GGCAGGGGCCAGGAATAGGCAGG + Intergenic
967297308 3:187977974-187977996 TGCAGCTGCCAGCAAGGAGGTGG - Intergenic
967399588 3:189045917-189045939 GGCTGGGGCCAGCAAGGGAAGGG + Intronic
967420081 3:189262864-189262886 GCCAGCTGCCAGCAAGGCCCTGG - Intronic
968393742 4:213860-213882 GGCAGCCGGCAGCAGGGTGCGGG - Intergenic
968441530 4:626862-626884 GGCAGCGGCCAGCAGAGACCTGG + Intronic
968442132 4:629381-629403 GGCCACGGCCACCAAGTGGCGGG + Intronic
968618214 4:1591880-1591902 GTCAGCAGCCAGAAAGGGGTGGG - Intergenic
968910772 4:3476040-3476062 GGCAGGGGCCAGGCTGGGGCAGG - Intronic
969443749 4:7232711-7232733 GGCAGCTCCCAGCAGGGTGCGGG - Intronic
969640076 4:8392402-8392424 GGCATCGGCCAGCAAGCCCCTGG - Exonic
970191399 4:13522712-13522734 GGCATCTGCCAGCTTGGGGCAGG - Intergenic
972315760 4:37924102-37924124 GGCAGGAGCCAGCAAGGTGTAGG - Intronic
974619788 4:64340532-64340554 AGCAGCAGGCAGCAGGGGGCTGG - Intronic
975949349 4:79749108-79749130 TGCTGTGGCCAGCAAGGGGTTGG - Intergenic
977511227 4:97965268-97965290 GGCTGCAGCCAGCCAGGGGGAGG + Intronic
981033971 4:140152085-140152107 GGGAGCGGCCTGGAGGGGGCGGG - Intronic
981885566 4:149668509-149668531 GGCAGCGGGGGGCAAGGGGAGGG + Intergenic
982094801 4:151912077-151912099 GGCTGCCTCCAGCCAGGGGCTGG - Intergenic
983650883 4:170035422-170035444 GACAGGGGCCAGGAAGTGGCTGG - Intergenic
983938436 4:173518845-173518867 GGAAGCGGGGAGCAGGGGGCGGG - Intergenic
985530294 5:430051-430073 GGCAGCGCCCAGAACAGGGCGGG - Intronic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
985988356 5:3535900-3535922 GGCAGCGTCCAGCAGGCGGAAGG + Intergenic
986030762 5:3890653-3890675 GGCAGCGTCCACCCTGGGGCTGG + Intergenic
986693740 5:10333965-10333987 GGCAGCGGCGACCCAGGGGCTGG + Intergenic
987071114 5:14337862-14337884 GCCAGCTGCCAGCCCGGGGCAGG - Intronic
993803844 5:92379179-92379201 GGCAGCTGACAGCAGGGCGCAGG + Intergenic
993946727 5:94124136-94124158 AGCAGCAGCAAGCAAGGGGAGGG + Intergenic
994973832 5:106776706-106776728 GGCAGCAGCCAGGATGGGGGAGG - Intergenic
995142294 5:108748461-108748483 GGCCGCGGCCGGGAAGTGGCCGG - Intronic
995759018 5:115544489-115544511 GGCAGCGGCCTGCCAGGGCTCGG - Intronic
997596954 5:135113470-135113492 GGCAGAGGCGGGCAGGGGGCTGG - Intronic
998156535 5:139789974-139789996 GGCAGAGAGCAGCACGGGGCCGG + Intergenic
999279813 5:150357749-150357771 GGCCGAGGCCAGGAAGCGGCGGG + Exonic
999592037 5:153158744-153158766 GGCAGCACCCAGGAAGAGGCAGG - Intergenic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1001956287 5:175850266-175850288 TGCAGGGCCCAGCAAGGGGGTGG + Intronic
1002000674 5:176194847-176194869 GGCGGGGGCCAGGCAGGGGCAGG + Intergenic
1002253665 5:177944134-177944156 GGCGGGGGCCAGGCAGGGGCAGG - Intergenic
1002279455 5:178122094-178122116 TGCAGAGGCCAGCCCGGGGCTGG + Exonic
1002688858 5:181036862-181036884 GGCAGCGGCCATCACGTGGAGGG - Intergenic
1003132088 6:3403443-3403465 AGCAGGGGCCAGCAAGGGCAAGG + Intronic
1003324953 6:5084641-5084663 GGCTGCGGCCAGACTGGGGCGGG - Exonic
1003577738 6:7313201-7313223 GGCTCCGGGCAGCGAGGGGCGGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006363083 6:33598240-33598262 GGCAGAGAGGAGCAAGGGGCAGG + Intergenic
1006374641 6:33665147-33665169 GGCACTGGCCAGCATGGAGCTGG - Exonic
1007521375 6:42453308-42453330 AGCAGCTGCGAGCAGGGGGCAGG + Intergenic
1012000400 6:93647243-93647265 GGCAGTGGGGAGCAAGGGGAGGG - Intergenic
1012128571 6:95461960-95461982 GGCGGCTTCCAGCAAGGGACTGG + Intergenic
1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG + Exonic
1012752868 6:103184889-103184911 AGGAGCAGCCAGCAAGGAGCTGG + Intergenic
1016239851 6:141917274-141917296 GGCAGCAGCGAGCATGGGGGAGG + Intergenic
1016738551 6:147506824-147506846 GGCGGCGGCCCGCGCGGGGCGGG + Intergenic
1016896684 6:149060575-149060597 GGGAGCGGCCAGCGTGGTGCAGG + Intronic
1017502919 6:155042139-155042161 GGCAGCCGCCTGAAAGGGACCGG - Intronic
1018216842 6:161536557-161536579 GCCAGCTGCCAGCCAGGTGCTGG + Intronic
1018920352 6:168168129-168168151 AGCAGCCAGCAGCAAGGGGCGGG + Intergenic
1019158056 6:170052041-170052063 GGCAGCAGGCAGCACAGGGCAGG - Intergenic
1019457776 7:1139603-1139625 GGCAGCAGCCAGCAAGGCTGAGG - Intergenic
1019702139 7:2479133-2479155 GGCAGTGCCCAGCATGGAGCTGG + Intergenic
1024643865 7:51355425-51355447 TGCAGAGGCCAGAAAGGGGATGG + Intergenic
1026483931 7:70801502-70801524 GGGAGGAGGCAGCAAGGGGCAGG - Intergenic
1026735355 7:72945524-72945546 GGCAGAGGCAAGCGAGGAGCCGG - Intronic
1026867912 7:73834710-73834732 GTCAGGGGCCAGCTGGGGGCTGG + Exonic
1026896592 7:74013221-74013243 GCCAGCGGCCAGCATGGCCCAGG + Intergenic
1027219346 7:76204078-76204100 GGCAGAGGTCAGCAAGAGGTTGG - Intronic
1029152434 7:98490545-98490567 GCCAGCGACCAGCAAAGAGCTGG + Intergenic
1030093913 7:105880976-105880998 TCCAGCAGCCTGCAAGGGGCAGG - Intronic
1030593811 7:111511814-111511836 AGCAGGGCCCAGCAAGGAGCTGG + Intronic
1031361717 7:120856825-120856847 GGCAGCGATCTGCAGGGGGCGGG + Exonic
1032076572 7:128838845-128838867 GCCAGAGGCTTGCAAGGGGCAGG + Intronic
1034787191 7:153936347-153936369 TGGAGCGGCCAGGATGGGGCTGG + Intronic
1035337397 7:158138617-158138639 GGCAGTGGCCACCTAGGGCCAGG + Intronic
1035667770 8:1391601-1391623 TGCAGAGTCCAGGAAGGGGCTGG + Intergenic
1036221168 8:6922765-6922787 CACAGCGGCCTGCAAGGGCCAGG - Intergenic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1037262894 8:17027489-17027511 GGCGGCGGCCGGCGGGGGGCTGG + Exonic
1037891857 8:22627830-22627852 GGCAGCTGCCAGCGTGGTGCAGG - Intronic
1038528555 8:28297693-28297715 GGCAGAGGCCTGCAAGGAGATGG - Intergenic
1038586022 8:28790035-28790057 GACACTGGACAGCAAGGGGCTGG + Intronic
1039542296 8:38382214-38382236 GGCGGCGGCCAGCACGGAGGCGG - Exonic
1039549016 8:38429947-38429969 GGCTGCAGCCACCACGGGGCCGG + Exonic
1047401481 8:124552168-124552190 GGCAGCAGCATGCATGGGGCTGG + Intronic
1048572025 8:135664426-135664448 TGCAGCAGCCAGCAAGGTGCCGG - Intergenic
1048901740 8:139044483-139044505 GGCAGCACCCAGCACAGGGCTGG + Intergenic
1048986849 8:139739297-139739319 GGGAGCGGCCAGCCAGGGCGGGG - Intronic
1049237079 8:141517826-141517848 GACAGTGGCCAGCTTGGGGCAGG - Intronic
1049339908 8:142106541-142106563 GGCCTCTGCCAGCAAGGGGACGG - Intergenic
1049574157 8:143382747-143382769 GGCAGCCTCCAGCATGAGGCGGG - Exonic
1049585666 8:143431333-143431355 GGCACCGGGAAGCACGGGGCGGG + Intergenic
1049657371 8:143804763-143804785 GGCAGCGGTCAGCAGGGAGACGG + Exonic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1051483599 9:17585194-17585216 GGCAGCGGCGAGAGAAGGGCAGG + Intronic
1051896678 9:21995359-21995381 GGGAGCGGCCAGCAGGGGAGGGG - Intronic
1053425305 9:38006270-38006292 TGCAGCGCCTAGCAAGAGGCAGG - Intronic
1053478908 9:38401605-38401627 GGCAGGGGGCAGGCAGGGGCTGG + Intergenic
1053941418 9:43253101-43253123 GCTAGAGGCCAGCAAGGGGAGGG - Intergenic
1054803613 9:69377413-69377435 GGCAGCGGCCACCAAGCAGACGG - Exonic
1056771986 9:89484187-89484209 GGGAGAGGCAAGCGAGGGGCCGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1060184590 9:121556580-121556602 GGCATCAGCCAGGAGGGGGCTGG - Intergenic
1060819758 9:126654533-126654555 GGAGGCAGCCAGCCAGGGGCTGG + Intronic
1061059215 9:128242357-128242379 GCCAGTGGTCATCAAGGGGCTGG + Intronic
1061166057 9:128922657-128922679 CGCAGCGCCCAGGAGGGGGCGGG + Intronic
1061710835 9:132486708-132486730 GGCAGCGAGCAGCGAGGTGCGGG - Intronic
1061719524 9:132543076-132543098 AGCGGCAGCCAGCAAGGTGCAGG - Intronic
1062350328 9:136135561-136135583 GACAGTAGCCAGCAAGGGCCAGG - Intergenic
1062441611 9:136572218-136572240 GGCAGAGCCCACCAAGGGGCCGG - Intergenic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1188408876 X:29846327-29846349 AGCAGGGACCAGCAAGGGGACGG - Intronic
1189304921 X:39979674-39979696 AGCAGCGGGCAGCTAGGGGTGGG + Intergenic
1189309052 X:40007393-40007415 GGCAGCGGCTCCTAAGGGGCGGG + Intergenic
1191662562 X:63666112-63666134 GGAAGAGGCCAGAAAGGGCCTGG + Intronic
1192173917 X:68874302-68874324 GGCATTTGCCAGCAAGGGGCGGG + Intergenic
1192543964 X:71997340-71997362 GACAGTCTCCAGCAAGGGGCTGG + Intergenic
1193402616 X:81064097-81064119 GGCAGCAGCCTGGCAGGGGCAGG + Intergenic
1195941443 X:110171229-110171251 GACAGAGGGCAGGAAGGGGCTGG + Intronic
1196196142 X:112840513-112840535 GCCAGCGGCCAGGGATGGGCAGG + Intronic
1198388043 X:136147400-136147422 GGGCGCGGCTAGCCAGGGGCGGG - Exonic
1199854483 X:151749463-151749485 GGCGGCGGCCAGCAACAGACAGG - Intergenic
1200092841 X:153643904-153643926 GGCTGGGGCCAGCCTGGGGCCGG + Intronic
1200141032 X:153903079-153903101 GGCAGGGGCCAAGCAGGGGCTGG + Intronic
1200213551 X:154357406-154357428 CGCAGCGGCCAACAGCGGGCGGG + Intronic
1200311810 X:155086006-155086028 GGTAGCGGCCAGCCTGGGTCTGG + Intronic