ID: 1152644768

View in Genome Browser
Species Human (GRCh38)
Location 17:81463673-81463695
Sequence ACTGCTCGCGCGCCACGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152644768_1152644776 19 Left 1152644768 17:81463673-81463695 CCAGGTCGTGGCGCGCGAGCAGT 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1152644776 17:81463715-81463737 CCGCAAGTGCCAGGACCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
1152644768_1152644774 15 Left 1152644768 17:81463673-81463695 CCAGGTCGTGGCGCGCGAGCAGT 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1152644774 17:81463711-81463733 GGAGCCGCAAGTGCCAGGACCGG 0: 1
1: 0
2: 1
3: 20
4: 156
1152644768_1152644771 10 Left 1152644768 17:81463673-81463695 CCAGGTCGTGGCGCGCGAGCAGT 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1152644771 17:81463706-81463728 GGCCCGGAGCCGCAAGTGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 133
1152644768_1152644770 -6 Left 1152644768 17:81463673-81463695 CCAGGTCGTGGCGCGCGAGCAGT 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1152644770 17:81463690-81463712 AGCAGTATGAGCAGATGGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152644768 Original CRISPR ACTGCTCGCGCGCCACGACC TGG (reversed) Exonic
905410022 1:37762130-37762152 ACTGCTAGCGCTCCACCTCCTGG - Intronic
1072070266 10:91908702-91908724 ACTGGTGGCGCGCCCCGTCCGGG + Exonic
1089556491 11:119318250-119318272 TCTGCTGGCGCGCCTCCACCAGG + Intronic
1095687309 12:45050741-45050763 GCCGCCCGCGCCCCACGACCCGG - Exonic
1117478399 14:56119062-56119084 ACTTCCCGCGCGCCGCGTCCGGG + Intronic
1145960284 17:28883183-28883205 ACTGCTCACAAGCCACGGCCAGG + Exonic
1150239940 17:63622914-63622936 CCCGCTCGCGCGCCGCGGCCCGG + Intronic
1152644768 17:81463673-81463695 ACTGCTCGCGCGCCACGACCTGG - Exonic
1160763381 19:796815-796837 ACTGCGGGCGCGCCATGATCCGG - Intergenic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1166768729 19:45267518-45267540 AGTCCTCGCGCTCCAAGACCAGG + Intronic
1167884934 19:52492773-52492795 ACTGTTCGCGGGCCCCGCCCAGG + Intronic
935265230 2:101387693-101387715 CCTCCTCGCGCGCCAGGTCCCGG + Intergenic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1185345905 22:50310535-50310557 AGTGCTCGCTCTCCACCACCTGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
984698227 4:182800141-182800163 GCTGCTCGCGCGCCCAGGCCCGG - Exonic
1013656691 6:112254070-112254092 CCTGCTCCCGCGCCGCGTCCGGG - Exonic
1029708507 7:102287394-102287416 GCTGCTCTCGCCCCACTACCCGG - Intronic
1060856713 9:126919864-126919886 AATGCTCGCCTCCCACGACCTGG - Intronic