ID: 1152644785

View in Genome Browser
Species Human (GRCh38)
Location 17:81463756-81463778
Sequence GCACCTACGACCCCACCACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152644777_1152644785 9 Left 1152644777 17:81463724-81463746 CCAGGACCGGCAGGACCTCTACT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG 0: 1
1: 0
2: 2
3: 11
4: 144
1152644772_1152644785 25 Left 1152644772 17:81463708-81463730 CCCGGAGCCGCAAGTGCCAGGAC 0: 1
1: 0
2: 2
3: 11
4: 137
Right 1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG 0: 1
1: 0
2: 2
3: 11
4: 144
1152644778_1152644785 3 Left 1152644778 17:81463730-81463752 CCGGCAGGACCTCTACTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG 0: 1
1: 0
2: 2
3: 11
4: 144
1152644773_1152644785 24 Left 1152644773 17:81463709-81463731 CCGGAGCCGCAAGTGCCAGGACC 0: 1
1: 1
2: 2
3: 4
4: 132
Right 1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG 0: 1
1: 0
2: 2
3: 11
4: 144
1152644775_1152644785 18 Left 1152644775 17:81463715-81463737 CCGCAAGTGCCAGGACCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG 0: 1
1: 0
2: 2
3: 11
4: 144
1152644782_1152644785 -6 Left 1152644782 17:81463739-81463761 CCTCTACTACCTGGCGGGCACCT 0: 1
1: 0
2: 2
3: 7
4: 78
Right 1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG 0: 1
1: 0
2: 2
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152644785 Original CRISPR GCACCTACGACCCCACCACC GGG Exonic
902102609 1:14004624-14004646 GCACCTACAAAACCAGCACCTGG - Intergenic
902725752 1:18334942-18334964 GCATCTACGACCGCGCCACCAGG + Exonic
902869848 1:19307387-19307409 GCATGTACAACGCCACCACCCGG - Exonic
903986685 1:27234261-27234283 GCACCTCCCACCCCACCACCGGG - Intergenic
905291031 1:36922038-36922060 GCCCCTATGACCACAGCACCAGG + Intronic
907032705 1:51187936-51187958 GCACCTACCACCACACTGCCTGG - Intergenic
909471561 1:76034660-76034682 GCACCTACCAACCCATCACCTGG + Intergenic
911989936 1:104682274-104682296 GCACCTATCAACCCATCACCTGG + Intergenic
915603795 1:156938516-156938538 GCACCGACACCACCACCACCAGG + Intronic
917141570 1:171841143-171841165 GCACCGCCGCCGCCACCACCGGG - Intergenic
921760153 1:218903759-218903781 GCACCTATCAACCCATCACCTGG - Intergenic
1063184071 10:3634594-3634616 GCACCTATCAACCCATCACCTGG + Intergenic
1063695728 10:8333146-8333168 GCACCTGCCACACCATCACCGGG - Intergenic
1066189986 10:33047349-33047371 GCACCTATCAACCCATCACCTGG + Intergenic
1069890633 10:71650120-71650142 CCACCTAAGAACACACCACCTGG - Intronic
1070452426 10:76575108-76575130 GCACCTATCAACCCATCACCTGG + Intergenic
1076351223 10:129816288-129816310 GGACCTGCAACGCCACCACCCGG - Intergenic
1077468108 11:2743279-2743301 GCACCTCAGACCCCACCTTCTGG - Intronic
1080184731 11:29468601-29468623 GCACCTATCAACCCATCACCTGG + Intergenic
1080842338 11:35996319-35996341 GCTCTTACTACCCCACCATCAGG - Intronic
1081274138 11:41126097-41126119 GCACCTATCAACCCATCACCTGG - Intronic
1081631125 11:44690717-44690739 CCAACTACCACCCCACCACCAGG + Intergenic
1081750232 11:45505375-45505397 GCCCCAAAGCCCCCACCACCTGG + Intergenic
1083661330 11:64252805-64252827 GCACCCCCCACCCCACCCCCAGG - Intronic
1084114017 11:67031364-67031386 GCACCTATAACCCCACCACCAGG - Intronic
1088372906 11:109110979-109111001 GCACCTATCAACCCATCACCTGG + Intergenic
1088517487 11:110654109-110654131 GCACCTATCAACCCAACACCTGG - Intronic
1089748209 11:120631812-120631834 GCTCCTACGACACCACCGCTGGG + Intronic
1090321658 11:125849908-125849930 GCACCTACCAACCCATCACCTGG - Intergenic
1091569153 12:1669437-1669459 GCACCTGGGGCCCCACGACCTGG + Intergenic
1091696282 12:2630405-2630427 CCTCCTAGGACCCAACCACCTGG + Intronic
1092188199 12:6497379-6497401 GCACCTATCAACCCATCACCTGG + Intronic
1092551190 12:9501939-9501961 ACACCTATAACCCCAGCACCTGG + Intergenic
1093101935 12:15038267-15038289 GCACCCACGGCCTCACCACCTGG - Intergenic
1093147360 12:15582338-15582360 ACACCTACACCACCACCACCAGG + Intronic
1094520616 12:31184417-31184439 ACACCTATAACCCCAGCACCTGG - Intergenic
1095884799 12:47177602-47177624 CCACCCCCCACCCCACCACCAGG - Intronic
1096623313 12:52878006-52878028 GCCCCTACTACTCCAGCACCTGG - Intergenic
1097642499 12:62199286-62199308 GCACCTATCAACCCATCACCTGG + Intronic
1098160279 12:67643062-67643084 GCACCAAAGACCCCATGACCTGG + Intergenic
1104912436 12:132245731-132245753 GCACCCACGACCCAGCCTCCTGG + Intronic
1110129443 13:71988980-71989002 GCACCTATTAACCCATCACCTGG - Intergenic
1113849092 13:113407876-113407898 GCACCCACGAGGCCCCCACCCGG + Intergenic
1113948086 13:114056106-114056128 GCACTGAGGACCCCACCACATGG + Intronic
1114269234 14:21091054-21091076 TCACCTACAGCGCCACCACCGGG - Exonic
1114269833 14:21093925-21093947 ACAGCTACCACCCCACCCCCTGG + Intronic
1115579842 14:34746898-34746920 GCACCTGCCACTCCACAACCAGG + Intergenic
1121996420 14:98606921-98606943 GCACCTCCAGCCCTACCACCTGG - Intergenic
1123939325 15:25209200-25209222 GGGCCCAAGACCCCACCACCTGG - Intergenic
1124557682 15:30742297-30742319 GCACCTATCAGCCCATCACCTGG - Intronic
1124718434 15:32090014-32090036 CCACCTACCACCCCACCAACAGG - Intronic
1126851398 15:52799027-52799049 GCACCCCCGACCACACCGCCAGG - Intergenic
1129392562 15:75227847-75227869 GCACCCCCGACCGCACCCCCAGG + Intergenic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1132054106 15:98636060-98636082 CCACCTACCTCCCCACCCCCAGG + Intergenic
1132150038 15:99452742-99452764 CCACCTCCCACCTCACCACCTGG + Intergenic
1132957576 16:2603627-2603649 GCACCTACTTCCTCACCACTGGG + Intergenic
1132970030 16:2682703-2682725 GCACCTACTTCCTCACCACTCGG + Exonic
1134002321 16:10792457-10792479 GGACCCACAACCCCACCCCCAGG + Intronic
1134109958 16:11509038-11509060 GCACCTATGTACCCACCAGCAGG + Intronic
1134905290 16:17974562-17974584 GCACCTATTAACCCATCACCTGG - Intergenic
1135755328 16:25092559-25092581 GCACCTGCCACCCAGCCACCAGG - Intergenic
1135960163 16:26988386-26988408 TCTCCTCCGCCCCCACCACCTGG - Intergenic
1138830901 16:60373675-60373697 GCACCTATCAACCCATCACCTGG + Intergenic
1141357805 16:83364977-83364999 GCACCTATCAACCCAACACCTGG - Intronic
1142794907 17:2300121-2300143 GCCCCTACTCTCCCACCACCTGG + Exonic
1144699376 17:17326847-17326869 ACATCTACAATCCCACCACCTGG + Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1144956494 17:19021362-19021384 GCACCCAGCACCCCACCACAGGG - Exonic
1146892150 17:36513238-36513260 GCCCCGTCCACCCCACCACCTGG + Intronic
1147246179 17:39122526-39122548 GAACCTAGGCCCCCAACACCAGG + Intronic
1149455396 17:56783908-56783930 GCACCTATCAACCCATCACCTGG + Intergenic
1150209954 17:63436429-63436451 GCACCACAGTCCCCACCACCAGG + Intronic
1151460205 17:74249805-74249827 GCCCCTCCCACCCCCCCACCTGG - Intronic
1152063733 17:78098444-78098466 GCACCCACGAGGCCACCTCCAGG + Exonic
1152605155 17:81285914-81285936 GCAGCAAAGACCCCACCTCCAGG + Intronic
1152644785 17:81463756-81463778 GCACCTACGACCCCACCACCGGG + Exonic
1152944137 17:83189914-83189936 GCACTTAGGACAACACCACCAGG + Intergenic
1153146856 18:2043105-2043127 GCACCTATCAACCCATCACCTGG - Intergenic
1153624125 18:7007148-7007170 ACACCTGTGACCCCAACACCGGG - Exonic
1156452151 18:37273015-37273037 GCACCTATGACCCCAACCTCAGG - Exonic
1160399286 18:78598091-78598113 CCACCTTCCACCCCACCACTTGG - Intergenic
1160889754 19:1371000-1371022 GCACCTTGGCCCCCACCTCCTGG - Exonic
1161283203 19:3456651-3456673 GCCCCTCCCACCCCACCAGCCGG - Intronic
1161682555 19:5687350-5687372 GCAGCGAGGACACCACCACCAGG - Exonic
1162077914 19:8200962-8200984 GCACCTATGATCCCACCTACTGG + Intronic
1162479624 19:10920911-10920933 GCACCTACAACCTCAGCAGCGGG + Exonic
1166107405 19:40604115-40604137 GCCCCTCCCACCCCACCTCCAGG - Intronic
1166938713 19:46350327-46350349 CCACCTTCCACCCCATCACCTGG - Intronic
1167840464 19:52113537-52113559 GCATCTACCAACCCATCACCTGG + Exonic
1168347633 19:55658761-55658783 GCACCCACAGCCCCACCATCAGG - Intronic
927045867 2:19277655-19277677 GCACCTATTAACCCACCATCAGG + Intergenic
932873396 2:75426085-75426107 GCACCTATCAACCCATCACCTGG + Intergenic
935653716 2:105403988-105404010 CCCCCCACGACCCCACCACAGGG - Intronic
936751566 2:115648520-115648542 GCACCTAAGAACCCATCACCTGG - Intronic
937219331 2:120332797-120332819 GCTCCCACGCCTCCACCACCCGG - Intergenic
938244014 2:129763636-129763658 GCACCTCCGTGCCCACCACAGGG + Intergenic
941002777 2:160219081-160219103 GCACCTATCAACCCATCACCTGG - Intronic
945144200 2:206719436-206719458 GCACCTATCAGCCCATCACCTGG - Intergenic
948644291 2:239393975-239393997 CCACCCCCAACCCCACCACCAGG + Intronic
948863465 2:240763953-240763975 GCCCCTCCCACCCCAGCACCCGG + Intronic
948869108 2:240789445-240789467 GGACCTAGGACCCCACTCCCAGG + Intronic
1170497135 20:16936831-16936853 GCACATATAACCCCACAACCTGG + Intergenic
1172777069 20:37414035-37414057 GCACCTGTGCCTCCACCACCCGG + Intergenic
1176306326 21:5125282-5125304 GCACCTTCGGCCCCCACACCTGG - Intronic
1178365478 21:31986073-31986095 GCATCTGGGTCCCCACCACCTGG - Intronic
1179667955 21:42925437-42925459 GGACCTACCACCCCTCCATCTGG - Intergenic
1179794414 21:43774570-43774592 GCACCTAAGACCACACAGCCCGG + Intronic
1179850732 21:44136748-44136770 GCACCTTCGGCCCCCACACCTGG + Intronic
1182070157 22:27457970-27457992 GCAGCCACCATCCCACCACCTGG + Intergenic
1184455331 22:44606865-44606887 CCACCTCCAAGCCCACCACCAGG + Intergenic
1184645264 22:45891777-45891799 ACACCTAGTACCCCACCCCCGGG + Intergenic
1184864238 22:47193380-47193402 GCCCCTGCGACGCCACCCCCAGG - Intergenic
952903533 3:38125529-38125551 CCCCCTATGACCCCACCGCCAGG + Intronic
954760980 3:52873630-52873652 GCACCTCCCACCCCACCCCTAGG - Intronic
955709145 3:61760687-61760709 GCACCTATCAACCCATCACCTGG + Intronic
960481530 3:118197396-118197418 GGCCCTCCAACCCCACCACCAGG + Intergenic
966545563 3:181142686-181142708 GCACCTATTAACCCATCACCAGG - Intergenic
967147778 3:186620655-186620677 GCACCTCCGTCCCCTCCACTTGG + Exonic
968084648 3:195868871-195868893 GCACCTCCGACCACTCCATCAGG + Intronic
968586048 4:1416518-1416540 GCTCCCACGACCCCACCGCACGG + Intergenic
969401927 4:6961489-6961511 GCACACACAGCCCCACCACCAGG - Intronic
969878422 4:10153360-10153382 GCACCTGGGACCCAGCCACCTGG - Intergenic
970888702 4:21017273-21017295 GCACCTATCAACCCATCACCTGG + Intronic
981913695 4:150010936-150010958 TTACCTACTACCCCACAACCTGG + Intergenic
984772195 4:183445267-183445289 GCAGCTGCGCCCACACCACCGGG - Intronic
990839685 5:60062981-60063003 GCACCTATCAACCCATCACCTGG - Intronic
999918401 5:156289389-156289411 GCCCCTACCAACCCATCACCTGG + Intronic
1010708217 6:79139583-79139605 GCACCTATCAACCCATCACCTGG - Intergenic
1018242271 6:161789391-161789413 GCACCTCCGTCCCCTCCAGCTGG + Intronic
1019364042 7:622238-622260 GCACCTCAGACCCGAGCACCAGG + Intronic
1019566268 7:1680681-1680703 GCACCCCCTACCCCACCCCCAGG + Intergenic
1026904155 7:74053276-74053298 GCACCTGGGATCCCAGCACCTGG - Exonic
1027885402 7:83898612-83898634 GCACCTATCAACCCATCACCTGG + Intergenic
1031036124 7:116789894-116789916 GCACCTATCAACCCATCACCTGG + Intronic
1031118576 7:117694797-117694819 GCACCTATCAACCCACCACCTGG - Intronic
1034968415 7:155405063-155405085 GCACCTGTGGCCCCACCACCGGG + Intergenic
1035827798 8:2663236-2663258 GCACCTACTAACCCATCATCTGG + Intergenic
1040447342 8:47508763-47508785 GCAGCTTCCACCCCACCATCAGG + Intronic
1040457522 8:47613947-47613969 GCACCTATCAACCCATCACCTGG + Intronic
1040636027 8:49274092-49274114 GCACCTATCAACCCATCACCTGG - Intergenic
1040947149 8:52895347-52895369 GCACCTACAGCCCCACCTCCTGG - Intergenic
1041053122 8:53956609-53956631 AAGCCAACGACCCCACCACCTGG - Intronic
1041657262 8:60366179-60366201 GCACCTATCAACCCATCACCTGG + Intergenic
1042523160 8:69735729-69735751 GCACCTACCAACCCATCACCTGG - Intronic
1043940449 8:86190261-86190283 GCACCTACAGTCCCAACACCAGG + Intergenic
1048077937 8:131093913-131093935 CCACCAAGGACACCACCACCAGG - Intergenic
1048620158 8:136123936-136123958 GCACCTACCAACCCGTCACCTGG + Intergenic
1048812745 8:138303499-138303521 GCACCTACCAACCCATCTCCAGG - Intronic
1050744325 9:8858401-8858423 GCACCGGCCACCCCACCTCCCGG - Intronic
1061619083 9:131799290-131799312 GCACCTGCTAACCCACCCCCAGG - Intergenic
1062439565 9:136563661-136563683 GCACCTAGGACCCCAGGGCCAGG + Intergenic
1062714260 9:137998099-137998121 GCAACCCCCACCCCACCACCAGG - Intronic
1185454952 X:304677-304699 GCACCGACGGCCCCTCCGCCCGG - Intronic
1188193034 X:27195885-27195907 GCACCTATCAACCCATCACCTGG - Intergenic
1190942273 X:55053429-55053451 GCACCTATTAACCCATCACCTGG - Intergenic
1196784737 X:119411780-119411802 GCACCTATCAACCCATCACCTGG - Intronic
1202143847 Y:21757739-21757761 GCACGTCAGACCCCAGCACCTGG - Intergenic