ID: 1152649302

View in Genome Browser
Species Human (GRCh38)
Location 17:81484545-81484567
Sequence AGCGCCTGTCTTTCCGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649302_1152649308 -10 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649308 17:81484558-81484580 GACAGGCGCTCCTCCTGGGTGGG No data
1152649302_1152649309 -4 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649309 17:81484564-81484586 CGCTCCTCCTGGGTGGGCCTTGG No data
1152649302_1152649318 29 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649302_1152649314 18 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649302_1152649310 -3 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649310 17:81484565-81484587 GCTCCTCCTGGGTGGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649302 Original CRISPR AGCGCCTGTCTTTCCGTGGC GGG (reversed) Intergenic