ID: 1152649304

View in Genome Browser
Species Human (GRCh38)
Location 17:81484549-81484571
Sequence GAGGAGCGCCTGTCTTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649304_1152649310 -7 Left 1152649304 17:81484549-81484571 CCACGGAAAGACAGGCGCTCCTC No data
Right 1152649310 17:81484565-81484587 GCTCCTCCTGGGTGGGCCTTGGG No data
1152649304_1152649314 14 Left 1152649304 17:81484549-81484571 CCACGGAAAGACAGGCGCTCCTC No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649304_1152649309 -8 Left 1152649304 17:81484549-81484571 CCACGGAAAGACAGGCGCTCCTC No data
Right 1152649309 17:81484564-81484586 CGCTCCTCCTGGGTGGGCCTTGG No data
1152649304_1152649318 25 Left 1152649304 17:81484549-81484571 CCACGGAAAGACAGGCGCTCCTC No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649304 Original CRISPR GAGGAGCGCCTGTCTTTCCG TGG (reversed) Intergenic