ID: 1152649311

View in Genome Browser
Species Human (GRCh38)
Location 17:81484568-81484590
Sequence GGTCCCAAGGCCCACCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649311_1152649318 6 Left 1152649311 17:81484568-81484590 CCTCCTGGGTGGGCCTTGGGACC No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649311_1152649314 -5 Left 1152649311 17:81484568-81484590 CCTCCTGGGTGGGCCTTGGGACC No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649311 Original CRISPR GGTCCCAAGGCCCACCCAGG AGG (reversed) Intergenic