ID: 1152649312

View in Genome Browser
Species Human (GRCh38)
Location 17:81484571-81484593
Sequence AGGGGTCCCAAGGCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649312_1152649314 -8 Left 1152649312 17:81484571-81484593 CCTGGGTGGGCCTTGGGACCCCT No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649312_1152649323 30 Left 1152649312 17:81484571-81484593 CCTGGGTGGGCCTTGGGACCCCT No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649312_1152649318 3 Left 1152649312 17:81484571-81484593 CCTGGGTGGGCCTTGGGACCCCT No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649312 Original CRISPR AGGGGTCCCAAGGCCCACCC AGG (reversed) Intergenic