ID: 1152649313

View in Genome Browser
Species Human (GRCh38)
Location 17:81484581-81484603
Sequence CAGGGCGCGAAGGGGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649313_1152649323 20 Left 1152649313 17:81484581-81484603 CCTTGGGACCCCTTCGCGCCCTG No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649313_1152649327 24 Left 1152649313 17:81484581-81484603 CCTTGGGACCCCTTCGCGCCCTG No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649313_1152649318 -7 Left 1152649313 17:81484581-81484603 CCTTGGGACCCCTTCGCGCCCTG No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649313 Original CRISPR CAGGGCGCGAAGGGGTCCCA AGG (reversed) Intergenic
No off target data available for this crispr