ID: 1152649314

View in Genome Browser
Species Human (GRCh38)
Location 17:81484586-81484608
Sequence GGACCCCTTCGCGCCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649303_1152649314 17 Left 1152649303 17:81484546-81484568 CCGCCACGGAAAGACAGGCGCTC No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649302_1152649314 18 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649304_1152649314 14 Left 1152649304 17:81484549-81484571 CCACGGAAAGACAGGCGCTCCTC No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649311_1152649314 -5 Left 1152649311 17:81484568-81484590 CCTCCTGGGTGGGCCTTGGGACC No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data
1152649312_1152649314 -8 Left 1152649312 17:81484571-81484593 CCTGGGTGGGCCTTGGGACCCCT No data
Right 1152649314 17:81484586-81484608 GGACCCCTTCGCGCCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649314 Original CRISPR GGACCCCTTCGCGCCCTGTG TGG Intergenic