ID: 1152649318

View in Genome Browser
Species Human (GRCh38)
Location 17:81484597-81484619
Sequence CGCCCTGTGTGGCCGCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649311_1152649318 6 Left 1152649311 17:81484568-81484590 CCTCCTGGGTGGGCCTTGGGACC No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649303_1152649318 28 Left 1152649303 17:81484546-81484568 CCGCCACGGAAAGACAGGCGCTC No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649302_1152649318 29 Left 1152649302 17:81484545-81484567 CCCGCCACGGAAAGACAGGCGCT No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649312_1152649318 3 Left 1152649312 17:81484571-81484593 CCTGGGTGGGCCTTGGGACCCCT No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649313_1152649318 -7 Left 1152649313 17:81484581-81484603 CCTTGGGACCCCTTCGCGCCCTG No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data
1152649304_1152649318 25 Left 1152649304 17:81484549-81484571 CCACGGAAAGACAGGCGCTCCTC No data
Right 1152649318 17:81484597-81484619 CGCCCTGTGTGGCCGCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649318 Original CRISPR CGCCCTGTGTGGCCGCCTCG TGG Intergenic