ID: 1152649323

View in Genome Browser
Species Human (GRCh38)
Location 17:81484624-81484646
Sequence CACCCCCGCCCCTCCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649321_1152649323 -8 Left 1152649321 17:81484609-81484631 CCGCCTCGTGGTGAGCACCCCCG No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649312_1152649323 30 Left 1152649312 17:81484571-81484593 CCTGGGTGGGCCTTGGGACCCCT No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649317_1152649323 10 Left 1152649317 17:81484591-81484613 CCTTCGCGCCCTGTGTGGCCGCC No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649316_1152649323 11 Left 1152649316 17:81484590-81484612 CCCTTCGCGCCCTGTGTGGCCGC No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649320_1152649323 1 Left 1152649320 17:81484600-81484622 CCTGTGTGGCCGCCTCGTGGTGA No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649315_1152649323 12 Left 1152649315 17:81484589-81484611 CCCCTTCGCGCCCTGTGTGGCCG No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649313_1152649323 20 Left 1152649313 17:81484581-81484603 CCTTGGGACCCCTTCGCGCCCTG No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data
1152649319_1152649323 2 Left 1152649319 17:81484599-81484621 CCCTGTGTGGCCGCCTCGTGGTG No data
Right 1152649323 17:81484624-81484646 CACCCCCGCCCCTCCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649323 Original CRISPR CACCCCCGCCCCTCCCTGCA AGG Intergenic