ID: 1152649327

View in Genome Browser
Species Human (GRCh38)
Location 17:81484628-81484650
Sequence CCCGCCCCTCCCTGCAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152649315_1152649327 16 Left 1152649315 17:81484589-81484611 CCCCTTCGCGCCCTGTGTGGCCG No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649313_1152649327 24 Left 1152649313 17:81484581-81484603 CCTTGGGACCCCTTCGCGCCCTG No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649322_1152649327 -7 Left 1152649322 17:81484612-81484634 CCTCGTGGTGAGCACCCCCGCCC No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649316_1152649327 15 Left 1152649316 17:81484590-81484612 CCCTTCGCGCCCTGTGTGGCCGC No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649319_1152649327 6 Left 1152649319 17:81484599-81484621 CCCTGTGTGGCCGCCTCGTGGTG No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649321_1152649327 -4 Left 1152649321 17:81484609-81484631 CCGCCTCGTGGTGAGCACCCCCG No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649320_1152649327 5 Left 1152649320 17:81484600-81484622 CCTGTGTGGCCGCCTCGTGGTGA No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data
1152649317_1152649327 14 Left 1152649317 17:81484591-81484613 CCTTCGCGCCCTGTGTGGCCGCC No data
Right 1152649327 17:81484628-81484650 CCCGCCCCTCCCTGCAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152649327 Original CRISPR CCCGCCCCTCCCTGCAAGGC CGG Intergenic