ID: 1152650021

View in Genome Browser
Species Human (GRCh38)
Location 17:81488384-81488406
Sequence TCGGCCCCGGAACATCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650021_1152650032 17 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650032 17:81488424-81488446 TTCCGGCGCCCGGGGCCTCCGGG No data
1152650021_1152650025 0 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650021_1152650029 9 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650029 17:81488416-81488438 GTTGCCGTTTCCGGCGCCCGGGG No data
1152650021_1152650036 26 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650036 17:81488433-81488455 CCGGGGCCTCCGGGATGTTCCGG No data
1152650021_1152650027 7 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650027 17:81488414-81488436 CTGTTGCCGTTTCCGGCGCCCGG No data
1152650021_1152650031 16 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650021_1152650037 27 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650021_1152650028 8 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data
1152650021_1152650038 28 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650038 17:81488435-81488457 GGGGCCTCCGGGATGTTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650021 Original CRISPR TCGGCCCCGGAACATCCCGG AGG (reversed) Intergenic