ID: 1152650024

View in Genome Browser
Species Human (GRCh38)
Location 17:81488403-81488425
Sequence AAACGGCAACAGGCACAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650024_1152650032 -2 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650032 17:81488424-81488446 TTCCGGCGCCCGGGGCCTCCGGG No data
1152650024_1152650029 -10 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650029 17:81488416-81488438 GTTGCCGTTTCCGGCGCCCGGGG No data
1152650024_1152650038 9 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650038 17:81488435-81488457 GGGGCCTCCGGGATGTTCCGGGG No data
1152650024_1152650031 -3 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650024_1152650037 8 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650024_1152650036 7 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650036 17:81488433-81488455 CCGGGGCCTCCGGGATGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650024 Original CRISPR AAACGGCAACAGGCACAACT CGG (reversed) Intergenic