ID: 1152650025

View in Genome Browser
Species Human (GRCh38)
Location 17:81488407-81488429
Sequence GTTGTGCCTGTTGCCGTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650009_1152650025 27 Left 1152650009 17:81488357-81488379 CCTTCGCGGGCTCTAAAGGCCCC No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650017_1152650025 6 Left 1152650017 17:81488378-81488400 CCGGGGCCTCCGGGATGTTCCGG No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650015_1152650025 8 Left 1152650015 17:81488376-81488398 CCCCGGGGCCTCCGGGATGTTCC No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650021_1152650025 0 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650016_1152650025 7 Left 1152650016 17:81488377-81488399 CCCGGGGCCTCCGGGATGTTCCG No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650008_1152650025 28 Left 1152650008 17:81488356-81488378 CCCTTCGCGGGCTCTAAAGGCCC No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650022_1152650025 -3 Left 1152650022 17:81488387-81488409 CCGGGATGTTCCGGGGCCGAGTT No data
Right 1152650025 17:81488407-81488429 GTTGTGCCTGTTGCCGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650025 Original CRISPR GTTGTGCCTGTTGCCGTTTC CGG Intergenic