ID: 1152650026

View in Genome Browser
Species Human (GRCh38)
Location 17:81488413-81488435
Sequence CGGGCGCCGGAAACGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650026_1152650037 -2 Left 1152650026 17:81488413-81488435 CCTGTTGCCGTTTCCGGCGCCCG No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650026_1152650043 26 Left 1152650026 17:81488413-81488435 CCTGTTGCCGTTTCCGGCGCCCG No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650026_1152650036 -3 Left 1152650026 17:81488413-81488435 CCTGTTGCCGTTTCCGGCGCCCG No data
Right 1152650036 17:81488433-81488455 CCGGGGCCTCCGGGATGTTCCGG No data
1152650026_1152650038 -1 Left 1152650026 17:81488413-81488435 CCTGTTGCCGTTTCCGGCGCCCG No data
Right 1152650038 17:81488435-81488457 GGGGCCTCCGGGATGTTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650026 Original CRISPR CGGGCGCCGGAAACGGCAAC AGG (reversed) Intergenic