ID: 1152650028

View in Genome Browser
Species Human (GRCh38)
Location 17:81488415-81488437
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650021_1152650028 8 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data
1152650015_1152650028 16 Left 1152650015 17:81488376-81488398 CCCCGGGGCCTCCGGGATGTTCC No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data
1152650023_1152650028 -5 Left 1152650023 17:81488397-81488419 CCGGGGCCGAGTTGTGCCTGTTG No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data
1152650017_1152650028 14 Left 1152650017 17:81488378-81488400 CCGGGGCCTCCGGGATGTTCCGG No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data
1152650022_1152650028 5 Left 1152650022 17:81488387-81488409 CCGGGATGTTCCGGGGCCGAGTT No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data
1152650016_1152650028 15 Left 1152650016 17:81488377-81488399 CCCGGGGCCTCCGGGATGTTCCG No data
Right 1152650028 17:81488415-81488437 TGTTGCCGTTTCCGGCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650028 Original CRISPR TGTTGCCGTTTCCGGCGCCC GGG Intergenic