ID: 1152650031

View in Genome Browser
Species Human (GRCh38)
Location 17:81488423-81488445
Sequence TTTCCGGCGCCCGGGGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650017_1152650031 22 Left 1152650017 17:81488378-81488400 CCGGGGCCTCCGGGATGTTCCGG No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650015_1152650031 24 Left 1152650015 17:81488376-81488398 CCCCGGGGCCTCCGGGATGTTCC No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650022_1152650031 13 Left 1152650022 17:81488387-81488409 CCGGGATGTTCCGGGGCCGAGTT No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650021_1152650031 16 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650024_1152650031 -3 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650016_1152650031 23 Left 1152650016 17:81488377-81488399 CCCGGGGCCTCCGGGATGTTCCG No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data
1152650023_1152650031 3 Left 1152650023 17:81488397-81488419 CCGGGGCCGAGTTGTGCCTGTTG No data
Right 1152650031 17:81488423-81488445 TTTCCGGCGCCCGGGGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650031 Original CRISPR TTTCCGGCGCCCGGGGCCTC CGG Intergenic