ID: 1152650037

View in Genome Browser
Species Human (GRCh38)
Location 17:81488434-81488456
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650026_1152650037 -2 Left 1152650026 17:81488413-81488435 CCTGTTGCCGTTTCCGGCGCCCG No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650021_1152650037 27 Left 1152650021 17:81488384-81488406 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650030_1152650037 -9 Left 1152650030 17:81488420-81488442 CCGTTTCCGGCGCCCGGGGCCTC No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650023_1152650037 14 Left 1152650023 17:81488397-81488419 CCGGGGCCGAGTTGTGCCTGTTG No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650024_1152650037 8 Left 1152650024 17:81488403-81488425 CCGAGTTGTGCCTGTTGCCGTTT No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data
1152650022_1152650037 24 Left 1152650022 17:81488387-81488409 CCGGGATGTTCCGGGGCCGAGTT No data
Right 1152650037 17:81488434-81488456 CGGGGCCTCCGGGATGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650037 Original CRISPR CGGGGCCTCCGGGATGTTCC GGG Intergenic