ID: 1152650043

View in Genome Browser
Species Human (GRCh38)
Location 17:81488462-81488484
Sequence GTTGTGCCTGTTGCCGTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650035_1152650043 6 Left 1152650035 17:81488433-81488455 CCGGGGCCTCCGGGATGTTCCGG No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650030_1152650043 19 Left 1152650030 17:81488420-81488442 CCGTTTCCGGCGCCCGGGGCCTC No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650040_1152650043 -3 Left 1152650040 17:81488442-81488464 CCGGGATGTTCCGGGGCCGAGTT No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650034_1152650043 7 Left 1152650034 17:81488432-81488454 CCCGGGGCCTCCGGGATGTTCCG No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650026_1152650043 26 Left 1152650026 17:81488413-81488435 CCTGTTGCCGTTTCCGGCGCCCG No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650033_1152650043 13 Left 1152650033 17:81488426-81488448 CCGGCGCCCGGGGCCTCCGGGAT No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data
1152650039_1152650043 0 Left 1152650039 17:81488439-81488461 CCTCCGGGATGTTCCGGGGCCGA No data
Right 1152650043 17:81488462-81488484 GTTGTGCCTGTTGCCGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650043 Original CRISPR GTTGTGCCTGTTGCCGTTTC CGG Intergenic