ID: 1152650055

View in Genome Browser
Species Human (GRCh38)
Location 17:81488507-81488529
Sequence AGACCAAGGCAGGGCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650055_1152650070 0 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650070 17:81488530-81488552 GGGAGGGGTCGCTAAGGGGGCGG No data
1152650055_1152650073 14 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650073 17:81488544-81488566 AGGGGGCGGAGGGCGCTCCTAGG No data
1152650055_1152650074 15 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650074 17:81488545-81488567 GGGGGCGGAGGGCGCTCCTAGGG No data
1152650055_1152650068 -4 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650068 17:81488526-81488548 GTCTGGGAGGGGTCGCTAAGGGG No data
1152650055_1152650067 -5 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650067 17:81488525-81488547 GGTCTGGGAGGGGTCGCTAAGGG No data
1152650055_1152650077 25 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650077 17:81488555-81488577 GGCGCTCCTAGGGGGCCCTGCGG No data
1152650055_1152650072 4 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650072 17:81488534-81488556 GGGGTCGCTAAGGGGGCGGAGGG No data
1152650055_1152650071 3 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650071 17:81488533-81488555 AGGGGTCGCTAAGGGGGCGGAGG No data
1152650055_1152650076 17 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650076 17:81488547-81488569 GGGCGGAGGGCGCTCCTAGGGGG No data
1152650055_1152650075 16 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650075 17:81488546-81488568 GGGGCGGAGGGCGCTCCTAGGGG No data
1152650055_1152650066 -6 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650066 17:81488524-81488546 TGGTCTGGGAGGGGTCGCTAAGG No data
1152650055_1152650069 -3 Left 1152650055 17:81488507-81488529 CCCCTCTGGCCCTGCCTTGGTCT No data
Right 1152650069 17:81488527-81488549 TCTGGGAGGGGTCGCTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650055 Original CRISPR AGACCAAGGCAGGGCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr