ID: 1152650138

View in Genome Browser
Species Human (GRCh38)
Location 17:81488750-81488772
Sequence CAGGAAAGGAAATGGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650125_1152650138 6 Left 1152650125 17:81488721-81488743 CCCGGGCCCTCCAGGCCTGTCAG No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650120_1152650138 19 Left 1152650120 17:81488708-81488730 CCCGACCCTGACGCCCGGGCCCT No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650126_1152650138 5 Left 1152650126 17:81488722-81488744 CCGGGCCCTCCAGGCCTGTCAGA No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650127_1152650138 0 Left 1152650127 17:81488727-81488749 CCCTCCAGGCCTGTCAGAGCCTC No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650122_1152650138 14 Left 1152650122 17:81488713-81488735 CCCTGACGCCCGGGCCCTCCAGG No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650128_1152650138 -1 Left 1152650128 17:81488728-81488750 CCTCCAGGCCTGTCAGAGCCTCC No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650121_1152650138 18 Left 1152650121 17:81488709-81488731 CCGACCCTGACGCCCGGGCCCTC No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650124_1152650138 13 Left 1152650124 17:81488714-81488736 CCTGACGCCCGGGCCCTCCAGGC No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650117_1152650138 27 Left 1152650117 17:81488700-81488722 CCTACTGACCCGACCCTGACGCC No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650131_1152650138 -9 Left 1152650131 17:81488736-81488758 CCTGTCAGAGCCTCCAGGAAAGG No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data
1152650129_1152650138 -4 Left 1152650129 17:81488731-81488753 CCAGGCCTGTCAGAGCCTCCAGG No data
Right 1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650138 Original CRISPR CAGGAAAGGAAATGGGCTGC GGG Intergenic
No off target data available for this crispr