ID: 1152650215

View in Genome Browser
Species Human (GRCh38)
Location 17:81489070-81489092
Sequence GCCCTCGGGGAGCAAAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650215_1152650225 20 Left 1152650215 17:81489070-81489092 CCGGAACTTTGCTCCCCGAGGGC No data
Right 1152650225 17:81489113-81489135 CCCCCAAGTCCTGGAGAGAAGGG No data
1152650215_1152650222 11 Left 1152650215 17:81489070-81489092 CCGGAACTTTGCTCCCCGAGGGC No data
Right 1152650222 17:81489104-81489126 AGAGCAGAACCCCCAAGTCCTGG No data
1152650215_1152650231 30 Left 1152650215 17:81489070-81489092 CCGGAACTTTGCTCCCCGAGGGC No data
Right 1152650231 17:81489123-81489145 CTGGAGAGAAGGGCAGAGGCCGG No data
1152650215_1152650223 19 Left 1152650215 17:81489070-81489092 CCGGAACTTTGCTCCCCGAGGGC No data
Right 1152650223 17:81489112-81489134 ACCCCCAAGTCCTGGAGAGAAGG No data
1152650215_1152650229 26 Left 1152650215 17:81489070-81489092 CCGGAACTTTGCTCCCCGAGGGC No data
Right 1152650229 17:81489119-81489141 AGTCCTGGAGAGAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650215 Original CRISPR GCCCTCGGGGAGCAAAGTTC CGG (reversed) Intergenic
No off target data available for this crispr