ID: 1152650507

View in Genome Browser
Species Human (GRCh38)
Location 17:81490382-81490404
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152650499_1152650507 5 Left 1152650499 17:81490354-81490376 CCAGCTGGAGGGAGTGTGGCCCT No data
Right 1152650507 17:81490382-81490404 CTGGTCAGGGGCCCCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152650507 Original CRISPR CTGGTCAGGGGCCCCCCAGT TGG Intergenic
No off target data available for this crispr