ID: 1152651023

View in Genome Browser
Species Human (GRCh38)
Location 17:81493022-81493044
Sequence CTGCTGTCCTGGGTCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152651023_1152651029 -3 Left 1152651023 17:81493022-81493044 CCTTTTCTGACCCAGGACAGCAG No data
Right 1152651029 17:81493042-81493064 CAGGGGAAGCCCCGCATTTGTGG No data
1152651023_1152651035 18 Left 1152651023 17:81493022-81493044 CCTTTTCTGACCCAGGACAGCAG No data
Right 1152651035 17:81493063-81493085 GGCCAGAGCCCTGGGATAGATGG No data
1152651023_1152651034 10 Left 1152651023 17:81493022-81493044 CCTTTTCTGACCCAGGACAGCAG No data
Right 1152651034 17:81493055-81493077 GCATTTGTGGCCAGAGCCCTGGG No data
1152651023_1152651033 9 Left 1152651023 17:81493022-81493044 CCTTTTCTGACCCAGGACAGCAG No data
Right 1152651033 17:81493054-81493076 CGCATTTGTGGCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152651023 Original CRISPR CTGCTGTCCTGGGTCAGAAA AGG (reversed) Intergenic
No off target data available for this crispr