ID: 1152651586

View in Genome Browser
Species Human (GRCh38)
Location 17:81496541-81496563
Sequence GCATCATTATGAACTTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152651586_1152651590 11 Left 1152651586 17:81496541-81496563 CCCAGACAAGTTCATAATGATGC No data
Right 1152651590 17:81496575-81496597 ATGCTTGCAGCCCGGCTCAATGG No data
1152651586_1152651589 3 Left 1152651586 17:81496541-81496563 CCCAGACAAGTTCATAATGATGC No data
Right 1152651589 17:81496567-81496589 AAATAAGAATGCTTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152651586 Original CRISPR GCATCATTATGAACTTGTCT GGG (reversed) Intergenic