ID: 1152651590

View in Genome Browser
Species Human (GRCh38)
Location 17:81496575-81496597
Sequence ATGCTTGCAGCCCGGCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152651586_1152651590 11 Left 1152651586 17:81496541-81496563 CCCAGACAAGTTCATAATGATGC No data
Right 1152651590 17:81496575-81496597 ATGCTTGCAGCCCGGCTCAATGG No data
1152651587_1152651590 10 Left 1152651587 17:81496542-81496564 CCAGACAAGTTCATAATGATGCC No data
Right 1152651590 17:81496575-81496597 ATGCTTGCAGCCCGGCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152651590 Original CRISPR ATGCTTGCAGCCCGGCTCAA TGG Intergenic