ID: 1152652645

View in Genome Browser
Species Human (GRCh38)
Location 17:81502709-81502731
Sequence GATTCCAAACGACCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152652637_1152652645 26 Left 1152652637 17:81502660-81502682 CCAGCAGGGAGCTGGACAGCACG No data
Right 1152652645 17:81502709-81502731 GATTCCAAACGACCACCAGCAGG No data
1152652643_1152652645 -6 Left 1152652643 17:81502692-81502714 CCTTTCCAGCAGGAAAGGATTCC No data
Right 1152652645 17:81502709-81502731 GATTCCAAACGACCACCAGCAGG No data
1152652636_1152652645 29 Left 1152652636 17:81502657-81502679 CCGCCAGCAGGGAGCTGGACAGC No data
Right 1152652645 17:81502709-81502731 GATTCCAAACGACCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152652645 Original CRISPR GATTCCAAACGACCACCAGC AGG Intergenic
No off target data available for this crispr