ID: 1152653019

View in Genome Browser
Species Human (GRCh38)
Location 17:81504898-81504920
Sequence GGCAGGTCTTTTGTTCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152653019_1152653027 18 Left 1152653019 17:81504898-81504920 CCCTTTGGAACAAAAGACCTGCC No data
Right 1152653027 17:81504939-81504961 GAAAGGAGAAAAATGAAAGAGGG No data
1152653019_1152653028 30 Left 1152653019 17:81504898-81504920 CCCTTTGGAACAAAAGACCTGCC No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653019_1152653023 1 Left 1152653019 17:81504898-81504920 CCCTTTGGAACAAAAGACCTGCC No data
Right 1152653023 17:81504922-81504944 TCTTCCACAAATAACCTGAAAGG No data
1152653019_1152653026 17 Left 1152653019 17:81504898-81504920 CCCTTTGGAACAAAAGACCTGCC No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152653019 Original CRISPR GGCAGGTCTTTTGTTCCAAA GGG (reversed) Intergenic
No off target data available for this crispr