ID: 1152653020

View in Genome Browser
Species Human (GRCh38)
Location 17:81504899-81504921
Sequence AGGCAGGTCTTTTGTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152653020_1152653028 29 Left 1152653020 17:81504899-81504921 CCTTTGGAACAAAAGACCTGCCT No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653020_1152653027 17 Left 1152653020 17:81504899-81504921 CCTTTGGAACAAAAGACCTGCCT No data
Right 1152653027 17:81504939-81504961 GAAAGGAGAAAAATGAAAGAGGG No data
1152653020_1152653026 16 Left 1152653020 17:81504899-81504921 CCTTTGGAACAAAAGACCTGCCT No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data
1152653020_1152653023 0 Left 1152653020 17:81504899-81504921 CCTTTGGAACAAAAGACCTGCCT No data
Right 1152653023 17:81504922-81504944 TCTTCCACAAATAACCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152653020 Original CRISPR AGGCAGGTCTTTTGTTCCAA AGG (reversed) Intergenic
No off target data available for this crispr