ID: 1152653022

View in Genome Browser
Species Human (GRCh38)
Location 17:81504919-81504941
Sequence TTCAGGTTATTTGTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152653022_1152653028 9 Left 1152653022 17:81504919-81504941 CCTTCTTCCACAAATAACCTGAA No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653022_1152653026 -4 Left 1152653022 17:81504919-81504941 CCTTCTTCCACAAATAACCTGAA No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data
1152653022_1152653027 -3 Left 1152653022 17:81504919-81504941 CCTTCTTCCACAAATAACCTGAA No data
Right 1152653027 17:81504939-81504961 GAAAGGAGAAAAATGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152653022 Original CRISPR TTCAGGTTATTTGTGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr