ID: 1152653024

View in Genome Browser
Species Human (GRCh38)
Location 17:81504926-81504948
Sequence TTCTCCTTTCAGGTTATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152653024_1152653027 -10 Left 1152653024 17:81504926-81504948 CCACAAATAACCTGAAAGGAGAA No data
Right 1152653027 17:81504939-81504961 GAAAGGAGAAAAATGAAAGAGGG No data
1152653024_1152653028 2 Left 1152653024 17:81504926-81504948 CCACAAATAACCTGAAAGGAGAA No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653024_1152653031 29 Left 1152653024 17:81504926-81504948 CCACAAATAACCTGAAAGGAGAA No data
Right 1152653031 17:81504978-81505000 AAGAGATTTAAGAGACATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152653024 Original CRISPR TTCTCCTTTCAGGTTATTTG TGG (reversed) Intergenic
No off target data available for this crispr