ID: 1152653026

View in Genome Browser
Species Human (GRCh38)
Location 17:81504938-81504960
Sequence TGAAAGGAGAAAAATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152653019_1152653026 17 Left 1152653019 17:81504898-81504920 CCCTTTGGAACAAAAGACCTGCC No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data
1152653022_1152653026 -4 Left 1152653022 17:81504919-81504941 CCTTCTTCCACAAATAACCTGAA No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data
1152653020_1152653026 16 Left 1152653020 17:81504899-81504921 CCTTTGGAACAAAAGACCTGCCT No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data
1152653021_1152653026 0 Left 1152653021 17:81504915-81504937 CCTGCCTTCTTCCACAAATAACC No data
Right 1152653026 17:81504938-81504960 TGAAAGGAGAAAAATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152653026 Original CRISPR TGAAAGGAGAAAAATGAAAG AGG Intergenic
No off target data available for this crispr