ID: 1152653028

View in Genome Browser
Species Human (GRCh38)
Location 17:81504951-81504973
Sequence ATGAAAGAGGGTAAATCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152653019_1152653028 30 Left 1152653019 17:81504898-81504920 CCCTTTGGAACAAAAGACCTGCC No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653025_1152653028 -8 Left 1152653025 17:81504936-81504958 CCTGAAAGGAGAAAAATGAAAGA No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653022_1152653028 9 Left 1152653022 17:81504919-81504941 CCTTCTTCCACAAATAACCTGAA No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653020_1152653028 29 Left 1152653020 17:81504899-81504921 CCTTTGGAACAAAAGACCTGCCT No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653021_1152653028 13 Left 1152653021 17:81504915-81504937 CCTGCCTTCTTCCACAAATAACC No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data
1152653024_1152653028 2 Left 1152653024 17:81504926-81504948 CCACAAATAACCTGAAAGGAGAA No data
Right 1152653028 17:81504951-81504973 ATGAAAGAGGGTAAATCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152653028 Original CRISPR ATGAAAGAGGGTAAATCCCG CGG Intergenic
No off target data available for this crispr