ID: 1152655376

View in Genome Browser
Species Human (GRCh38)
Location 17:81517010-81517032
Sequence CTGGCTAATTACCCTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 68}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152655376_1152655388 27 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655388 17:81517060-81517082 AAGGTTCTGGAGGGCGGTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 197
1152655376_1152655383 14 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655383 17:81517047-81517069 TCTGGGAGGTCAGAAGGTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 245
1152655376_1152655385 18 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655385 17:81517051-81517073 GGAGGTCAGAAGGTTCTGGAGGG 0: 1
1: 1
2: 1
3: 37
4: 350
1152655376_1152655387 26 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655387 17:81517059-81517081 GAAGGTTCTGGAGGGCGGTGTGG 0: 1
1: 0
2: 3
3: 31
4: 328
1152655376_1152655380 -3 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655380 17:81517030-81517052 CAGAAACAAGGTCACATTCTGGG 0: 1
1: 0
2: 4
3: 24
4: 263
1152655376_1152655379 -4 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655379 17:81517029-81517051 CCAGAAACAAGGTCACATTCTGG 0: 1
1: 0
2: 2
3: 23
4: 184
1152655376_1152655386 21 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655386 17:81517054-81517076 GGTCAGAAGGTTCTGGAGGGCGG 0: 1
1: 0
2: 1
3: 33
4: 333
1152655376_1152655382 8 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655382 17:81517041-81517063 TCACATTCTGGGAGGTCAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 264
1152655376_1152655381 0 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655381 17:81517033-81517055 AAACAAGGTCACATTCTGGGAGG 0: 1
1: 1
2: 10
3: 38
4: 271
1152655376_1152655384 17 Left 1152655376 17:81517010-81517032 CCTGGGTCAGGGTAATTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 68
Right 1152655384 17:81517050-81517072 GGGAGGTCAGAAGGTTCTGGAGG 0: 1
1: 0
2: 1
3: 23
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152655376 Original CRISPR CTGGCTAATTACCCTGACCC AGG (reversed) Intronic
907358251 1:53894086-53894108 CTGACTCCTTCCCCTGACCCGGG + Intronic
913502206 1:119481722-119481744 CTCCCTCATTACCCTGCCCCAGG + Intergenic
917364738 1:174217733-174217755 CTAGCTAATTACACTGGTCCAGG + Intronic
917772146 1:178291332-178291354 CTTGCTAAATACCCTTTCCCTGG - Intronic
921046881 1:211484159-211484181 CTGCCTACCTCCCCTGACCCCGG + Intronic
924783865 1:247176666-247176688 CAGGCCAATATCCCTGACCCAGG + Intergenic
1066388233 10:34958541-34958563 CTTGCTAACTACCCTCACTCTGG - Intergenic
1066623530 10:37382554-37382576 CTGCCTGATTACACTGACCCAGG + Intronic
1067684728 10:48459424-48459446 CATGCTAATAAACCTGACCCAGG - Intronic
1067947867 10:50702063-50702085 CTGGTTAGTCACCCTGACCCTGG - Intergenic
1069981148 10:72253666-72253688 CTGCCTACTTGCCCTGAGCCAGG + Intergenic
1070883182 10:79867060-79867082 CTGGTTAGTCACCCTGACCCTGG - Intergenic
1071649749 10:87383367-87383389 CTGGTTAGTCACCCTGACCCTGG - Intergenic
1071812384 10:89197863-89197885 CTGGCTAATGAGCTTGAACCTGG + Intergenic
1073454742 10:103629721-103629743 CTGTCTACTTCCCTTGACCCAGG + Intronic
1073459975 10:103660760-103660782 CTGGTTAATTACCCCGAGCAAGG + Intronic
1077170727 11:1164778-1164800 CTGGCTGATGCCCCTGTCCCGGG + Intronic
1077170762 11:1164875-1164897 CTGGCTGATGCCCCTGTCCCGGG + Intronic
1077170783 11:1164940-1164962 CTGGCTGATGCCCCTGTCCCGGG + Intronic
1077170856 11:1165133-1165155 CTGGCTGATGCCCCTGTCCCGGG + Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079132463 11:17755446-17755468 CTGGTCTATTACCATGACCCGGG + Intronic
1079240000 11:18715384-18715406 CTGACCAATCCCCCTGACCCTGG - Intronic
1088360338 11:108982768-108982790 CTGGCTAGAGACCTTGACCCTGG + Intergenic
1091980098 12:4857834-4857856 CTGGCTAATTACCACGATCGTGG + Intergenic
1102234769 12:111287373-111287395 TTGTCTAACTTCCCTGACCCCGG + Intronic
1103860345 12:124007349-124007371 CTGGCGGAGTACCCTAACCCTGG + Intronic
1110393036 13:74997869-74997891 CTTTCTTATTACACTGACCCAGG - Intergenic
1111411154 13:87878499-87878521 CTGGATAATCACCATCACCCTGG + Intergenic
1116611667 14:47081495-47081517 CTGCCTAATTTTCCTGACCTTGG - Intronic
1121395839 14:93622514-93622536 CTGGATGATCACCCTGACCCGGG + Exonic
1121951543 14:98175174-98175196 CCTGCTAATTGCCCTGACCTAGG - Intergenic
1125815294 15:42578961-42578983 ATGGCTTATTACTCTCACCCTGG + Intronic
1129206751 15:74041784-74041806 CTGGCTAATGTCCCTGGCCTAGG - Intronic
1139967072 16:70751645-70751667 CTGGCTAATGCCCCTAAACCAGG - Intronic
1146001022 17:29130592-29130614 CTGGCTAATCAAACTGACCAAGG + Intronic
1149222722 17:54434289-54434311 CTGGTTAAATACCTGGACCCTGG - Intergenic
1150622998 17:66822493-66822515 CTGGCTCATGACCATGACCCCGG - Intergenic
1152655376 17:81517010-81517032 CTGGCTAATTACCCTGACCCAGG - Intronic
1159610381 18:70518532-70518554 CTGGCTGATTTCCCTGCCCACGG + Intergenic
1161366720 19:3884123-3884145 CTGGCTAATTTCTCTGATCTTGG - Intronic
1161423174 19:4186870-4186892 CTGGCTGATTCCCCTGTGCCTGG - Intronic
1161468924 19:4446824-4446846 CTGTCCACTTACCCTGATCCTGG + Exonic
1162917577 19:13882610-13882632 GTGGCAAATGACCTTGACCCTGG + Exonic
1163322410 19:16582493-16582515 CTGGCTTCTGACCCTGGCCCTGG + Intronic
926263655 2:11293094-11293116 TTGGCTCATTACCCTGAGACTGG - Intronic
937286998 2:120760117-120760139 CTGGCCCATCACCCTGCCCCTGG - Intronic
938565204 2:132512705-132512727 CTGTGTAATTACTCTGAGCCAGG - Intronic
939095612 2:137830290-137830312 CTGGCCAATTACCCTGGATCTGG + Intergenic
940633909 2:156273601-156273623 TTGGCTATTTACCGTGAGCCAGG - Intergenic
1173015915 20:39225599-39225621 CTCAATAATGACCCTGACCCTGG - Intergenic
1175715344 20:61251852-61251874 CTTGCTAACTCCCCTGACCCGGG - Intergenic
1178683198 21:34690599-34690621 GTGACTCATTACCCTGACACTGG + Intronic
1178882960 21:36463121-36463143 CTCGCTGATTACCTTGCCCCAGG - Intronic
950239013 3:11351178-11351200 CTGTCTAGTTCCCCTGTCCCTGG - Intronic
959887498 3:111519538-111519560 CTGTCTAACTTTCCTGACCCAGG - Intronic
961003123 3:123387382-123387404 CTGGCTAGTTTCCCCAACCCTGG - Intronic
962670983 3:137708408-137708430 CTGGCTAATGAGCCTGACCCTGG - Intergenic
980650276 4:135704630-135704652 ATGGCTAATTACCCGGCTCCAGG + Intergenic
984681099 4:182609744-182609766 ATGTGTAATTACCCTGACCAAGG - Intronic
991163225 5:63530516-63530538 CTAGCAAATTGCCCTGACCTTGG - Intergenic
991550121 5:67826380-67826402 CTGGCTAAGAAACCTTACCCAGG - Intergenic
999062647 5:148653079-148653101 GTGGATATTTACCCTGTCCCTGG - Intronic
1000127920 5:158265437-158265459 CTGGGTAAATACACTCACCCAGG - Intergenic
1003865451 6:10358505-10358527 CTGGCTAATTAGCATGGCCCTGG - Intergenic
1006906173 6:37535339-37535361 ATGCCTAATTTCCCGGACCCAGG - Intergenic
1017899422 6:158706260-158706282 CTGGCTAAGGACCCTGATCTAGG + Intronic
1018869442 6:167770025-167770047 CTGGCTAGGAACCCTGACTCCGG + Intergenic
1026271994 7:68844798-68844820 CTGTCTAATCACCAGGACCCAGG + Intergenic
1031399795 7:121316634-121316656 TGGGCTACTTACCCTGTCCCCGG - Intergenic
1033125031 7:138699887-138699909 TTGGCAAATTCCCCTGACACCGG - Intronic
1036236946 8:7047366-7047388 CTGGCTCATTTCCCAGACCTGGG - Intergenic
1041730358 8:61056150-61056172 CTGCCTCTTTACCCAGACCCTGG - Intergenic
1042661399 8:71158368-71158390 CTGGCTAATTCTCCAGATCCTGG - Intergenic
1056538352 9:87550931-87550953 TTGGATACATACCCTGACCCCGG + Intronic
1186578962 X:10796630-10796652 CTGGCCAATCACCCTGAACAAGG - Intronic
1186793891 X:13025300-13025322 CTGGCTAAGCCCCCTGAACCGGG - Intergenic
1187236999 X:17476837-17476859 CGGGCTAATTTTCCTGAACCAGG - Intronic