ID: 1152656091

View in Genome Browser
Species Human (GRCh38)
Location 17:81519784-81519806
Sequence GGACCCCGGACATCTAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152656091_1152656094 -8 Left 1152656091 17:81519784-81519806 CCCACGCTAGATGTCCGGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1152656094 17:81519799-81519821 CGGGGTCCCTCCTGCGACCGAGG 0: 1
1: 0
2: 1
3: 3
4: 94
1152656091_1152656098 0 Left 1152656091 17:81519784-81519806 CCCACGCTAGATGTCCGGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1152656098 17:81519807-81519829 CTCCTGCGACCGAGGACAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1152656091_1152656101 12 Left 1152656091 17:81519784-81519806 CCCACGCTAGATGTCCGGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1152656101 17:81519819-81519841 AGGACAGGAGGCACCCACAGAGG 0: 1
1: 0
2: 5
3: 41
4: 354
1152656091_1152656104 26 Left 1152656091 17:81519784-81519806 CCCACGCTAGATGTCCGGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1152656104 17:81519833-81519855 CCACAGAGGACCCCAACACGAGG 0: 1
1: 0
2: 1
3: 9
4: 124
1152656091_1152656095 -3 Left 1152656091 17:81519784-81519806 CCCACGCTAGATGTCCGGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1152656095 17:81519804-81519826 TCCCTCCTGCGACCGAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152656091 Original CRISPR GGACCCCGGACATCTAGCGT GGG (reversed) Intronic
902151982 1:14450713-14450735 AAACCCCGGACATCAAGTGTGGG + Intergenic
905519371 1:38586463-38586485 GTACCCAGGACATCTTGCCTCGG + Intergenic
924482666 1:244451436-244451458 GGACCCCTGACCTGGAGCGTCGG - Intronic
1064185918 10:13161696-13161718 GGACCCCGCGCCTCTAGCCTCGG - Intronic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1075103715 10:119523682-119523704 GTACCCCTGACATCCAGCATAGG - Intronic
1077018141 11:406047-406069 GGCCCCCGGACACCTGGGGTGGG + Exonic
1094027144 12:25970677-25970699 GGACCTCGGACATCTGGCTCTGG + Intronic
1097070971 12:56354696-56354718 GGACCCTGGTCCTCTAGCGCTGG - Intronic
1133116811 16:3582255-3582277 GGACCTGGGACACCCAGCGTGGG - Exonic
1133204361 16:4224107-4224129 GGACCCCGGGCATCTGGAGGAGG + Intronic
1143595378 17:7910863-7910885 GTACCCCGGAGGTGTAGCGTAGG - Exonic
1143720231 17:8804003-8804025 GGGCCCTGGACATCTAGGGTTGG + Intronic
1152656091 17:81519784-81519806 GGACCCCGGACATCTAGCGTGGG - Intronic
1160424865 18:78772856-78772878 GGACCCCTGACATCAGGCGAGGG - Intergenic
1160895582 19:1400538-1400560 GGACCCGGGACAAACAGCGTGGG - Intronic
948998338 2:241596137-241596159 GGACCCCAGACATCTAAAGGTGG + Intronic
955344099 3:58148390-58148412 GGAGCCAGGACATCTTGGGTGGG + Intronic
959231442 3:103658061-103658083 GGATCCCGGAAATCAAGCTTTGG - Intergenic
968910944 4:3476685-3476707 GGACCTTGGACATCGAGCGTGGG - Intronic
969620885 4:8278293-8278315 TGACACCGGACACCTAGCCTCGG + Intronic
990393116 5:55348154-55348176 GGACCCAGCACATCTAGTGAGGG + Intronic
993294577 5:86119749-86119771 GAACCCAGGAGATCTAGCCTGGG - Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
1024573180 7:50742471-50742493 GGTCCCCGGACATACAGCATGGG + Intronic
1031216411 7:118898792-118898814 GGACCCAGGACATCAAGCTTTGG - Intergenic
1036798223 8:11770948-11770970 GGACCGCCGACCACTAGCGTGGG - Intronic
1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG + Exonic
1044280208 8:90345901-90345923 GGAGCCTGGAAATCTAGGGTGGG - Intergenic
1189446341 X:41085125-41085147 GGAACCCGGAGAGCTAGGGTGGG - Intergenic
1197916223 X:131538940-131538962 AGACCCCAGACATCTTGAGTAGG + Intergenic