ID: 1152656244

View in Genome Browser
Species Human (GRCh38)
Location 17:81520310-81520332
Sequence GGTCACACCATGCCCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152656236_1152656244 3 Left 1152656236 17:81520284-81520306 CCTGAAGGTGGAGAGGCCCGAGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1152656244 17:81520310-81520332 GGTCACACCATGCCCAGGGAAGG 0: 1
1: 0
2: 1
3: 22
4: 206
1152656235_1152656244 4 Left 1152656235 17:81520283-81520305 CCCTGAAGGTGGAGAGGCCCGAG 0: 1
1: 0
2: 1
3: 9
4: 188
Right 1152656244 17:81520310-81520332 GGTCACACCATGCCCAGGGAAGG 0: 1
1: 0
2: 1
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152656244 Original CRISPR GGTCACACCATGCCCAGGGA AGG Intronic
900139391 1:1133241-1133263 GGTCACACCCACCCCAGGGAAGG + Intergenic
900568562 1:3347301-3347323 GGAGAAACCAGGCCCAGGGAGGG + Intronic
901182132 1:7349054-7349076 GGACACAATATGCCCTGGGATGG - Intronic
901487621 1:9575952-9575974 GGTGACAGCATGACCAGGAAGGG - Intronic
901625882 1:10624798-10624820 GGTCACAGCATGGCCAGGAGGGG + Intronic
901923035 1:12549410-12549432 GGCCACCCCAGGGCCAGGGAAGG - Intergenic
901923667 1:12552818-12552840 GGCCACCCCAAGGCCAGGGAAGG - Intergenic
902774243 1:18664432-18664454 GGGAACACCATGCCTGGGGAAGG + Intronic
904266083 1:29319265-29319287 GGGCACACCAAGGCCAAGGAGGG - Intronic
904420691 1:30389357-30389379 GGCCTCACCCTGCCCTGGGATGG - Intergenic
904740002 1:32667013-32667035 GGTAACACCATTGCCTGGGAAGG + Intronic
904987469 1:34563703-34563725 TGTCACACCATGGCCTGGAAGGG - Intergenic
905209281 1:36362326-36362348 GGTCACAGGATGCCCAGTGTGGG + Intronic
913175645 1:116270642-116270664 TGTCACACCAGTCCCAGGTAAGG - Intergenic
913599313 1:120407546-120407568 GCTCACACCATGCACTTGGAGGG - Intergenic
913699123 1:121357106-121357128 GTTCACATCATGCCAAGGAATGG + Intronic
914088066 1:144472071-144472093 GCTCACACCATGCACTTGGAGGG + Intergenic
914138423 1:144922939-144922961 GTTCACATCATGCCAAGGAATGG - Intronic
914310546 1:146462135-146462157 GCTCACACCATGCACTTGGAGGG - Intergenic
914314635 1:146498617-146498639 GCTCACACCATGCACTTGGAGGG + Intergenic
914499715 1:148234771-148234793 GCTCACACCATGCACTTGGAGGG - Intergenic
914591561 1:149111006-149111028 GCTCACACCATGCACTTGGAGGG + Intergenic
916719844 1:167476279-167476301 TGGTACACCAGGCCCAGGGATGG + Intronic
920486533 1:206375818-206375840 GTTCACATCATGCCAAGGAATGG + Intronic
920640192 1:207744280-207744302 GTTCAGTCTATGCCCAGGGATGG + Intergenic
920668343 1:207983175-207983197 GGTCCCAGCATGCCCAGGGATGG - Intergenic
920803529 1:209211151-209211173 GGGCTCACTATGACCAGGGAAGG + Intergenic
921813664 1:219543028-219543050 GATGACATCAGGCCCAGGGAAGG + Intergenic
922422916 1:225471535-225471557 GGTCTTGCCCTGCCCAGGGAGGG - Intergenic
922687754 1:227659416-227659438 GTTCACACCATGGCCAGAGATGG + Exonic
924640132 1:245825567-245825589 GGGGACAAGATGCCCAGGGAGGG - Intronic
1063713935 10:8508873-8508895 TTTCATACCATGCCCAGGGCTGG + Intergenic
1066961232 10:42230252-42230274 GGTAAAAACATGGCCAGGGAGGG + Intergenic
1067088019 10:43253068-43253090 GTGCACACCCAGCCCAGGGAGGG + Intronic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1067713415 10:48668347-48668369 GATGACATCAGGCCCAGGGAAGG - Intergenic
1073139510 10:101238128-101238150 GGTCACTCCAGGCCCTGCGAGGG - Intergenic
1075923209 10:126230109-126230131 TGTCTTACCAAGCCCAGGGAAGG + Intronic
1076067257 10:127458658-127458680 GGTCAGTCCAAGCCCAGGCAAGG - Intergenic
1076068950 10:127470784-127470806 GCCCTCACCATGGCCAGGGATGG - Intergenic
1076538064 10:131195696-131195718 GGACACAGCAGGCCGAGGGAAGG - Intronic
1076547769 10:131257284-131257306 GGACACCCCATCCCCTGGGAGGG + Intronic
1077302748 11:1854806-1854828 GGTCACCTCATGCCCATAGAAGG + Intronic
1077510855 11:2961608-2961630 GGCCACCCCATGCCCTGGGTTGG - Intronic
1078041853 11:7872259-7872281 GTCCACACCATGACCAGGTAAGG + Intergenic
1078380478 11:10835548-10835570 GGTCTCATCTTGCACAGGGATGG + Intronic
1078908462 11:15709163-15709185 GGTCACACCTTGCTCAGAGGAGG - Intergenic
1079345835 11:19651523-19651545 GGTCAGACCATGCCTTGGGTTGG + Intronic
1080641536 11:34161221-34161243 GGCCACTCCATGCCCAGGAAGGG - Intronic
1081616365 11:44593571-44593593 GGGCACAGCATGCCCAAGCATGG + Intronic
1083768228 11:64852498-64852520 GCTCCCACCTTGCTCAGGGAAGG + Exonic
1083960325 11:66011803-66011825 GGACACACCTGGCCCGGGGAGGG - Intergenic
1084307551 11:68296927-68296949 GGTGACAGCAGGCCCAGGGAGGG + Intergenic
1084394291 11:68898672-68898694 GGTCCCAGCATGGCCAGTGAGGG + Intronic
1085725051 11:78947830-78947852 GTTCCCTCCATGCCCAGGAAGGG + Intronic
1088013703 11:105034647-105034669 GGTCACTCCATGCACATGTATGG - Intronic
1088175361 11:107047537-107047559 GGTCATGCCATGCCCAGAGTTGG - Intergenic
1090203003 11:124869273-124869295 GGCCACACCACGGCCAGAGAAGG + Intronic
1091086184 11:132724135-132724157 GGTCAGAGCATGTCCAGGAATGG + Intronic
1105759564 13:23501633-23501655 GCTCAAGCGATGCCCAGGGAAGG - Intergenic
1105995053 13:25663002-25663024 ATTCACACAATGCACAGGGAAGG - Intronic
1106493958 13:30257489-30257511 GGTCACAGCAAGCCCAGCCATGG - Intronic
1110953180 13:81520565-81520587 GTTCAGCCTATGCCCAGGGATGG - Intergenic
1111255362 13:85660817-85660839 CATCACACCATGCCCAAGTAAGG - Intergenic
1115492592 14:33972696-33972718 AGTCACACCAGGCCCAGGTAGGG + Intronic
1116527971 14:45930715-45930737 GGTCACACATGGCCCAGGAATGG + Intergenic
1118324692 14:64773065-64773087 TGTCACACCTTCCCCAGGGCAGG + Intronic
1118324981 14:64774575-64774597 GGGCACAACTTGCCAAGGGAGGG - Intronic
1121760920 14:96444224-96444246 GGCCCCTCCATCCCCAGGGATGG - Intronic
1202861910 14_GL000225v1_random:88848-88870 GGTCTCACCCAGCCCAGGGGAGG + Intergenic
1123948101 15:25248625-25248647 GCACCCACCATGCCCAGGGTAGG + Intergenic
1124204970 15:27709972-27709994 AGCCACAGCATGCCCAGGGAAGG - Intergenic
1127029040 15:54841181-54841203 GGTAACTCCATGCCCAGAAAAGG - Intergenic
1129774783 15:78229670-78229692 GGTCCCATCTGGCCCAGGGAGGG - Intronic
1132152648 15:99473564-99473586 GGTCACAGCATGCACAGTGCTGG - Intergenic
1132670125 16:1099085-1099107 TGGGACACCATGGCCAGGGAGGG - Intergenic
1132715257 16:1286881-1286903 GCTCACCCCCTGGCCAGGGAAGG - Intergenic
1132727168 16:1343914-1343936 GGGCTGACCATGCCCGGGGAAGG + Intronic
1133445153 16:5853389-5853411 GGTCAGGCCGTGCCCAGGGCAGG - Intergenic
1133774744 16:8887701-8887723 GGTCACACCAGCCCCGGGGAAGG + Intergenic
1135503896 16:23019960-23019982 GGTCTGACCCTGCCCAGGGCTGG - Intergenic
1136297194 16:29310266-29310288 GGTCACACCATGGCTAGAGATGG - Intergenic
1137018494 16:35399011-35399033 GGTCAAAACATGAGCAGGGAGGG - Intergenic
1137607324 16:49795545-49795567 GGTCACACTCAGCCCTGGGAAGG - Intronic
1138819054 16:60236299-60236321 GCTCACACCATGCCCAAACAAGG + Intergenic
1141691847 16:85601120-85601142 GGATACAGCAGGCCCAGGGAAGG + Intergenic
1142058745 16:88016368-88016390 GGTCACACCATGGCTAGAGATGG - Intronic
1145067021 17:19768527-19768549 GGCCACACCAGCCTCAGGGAGGG + Intergenic
1145179306 17:20731708-20731730 GGTCTCACCTTGCCCAGGCTGGG + Intergenic
1145983269 17:29027028-29027050 GGTCACCACAGGCTCAGGGAGGG + Intronic
1146761209 17:35481141-35481163 GGTAACACCAGCGCCAGGGAAGG + Intronic
1146909124 17:36636928-36636950 GCTCTAACCATGCCCAGTGAAGG - Intergenic
1152535800 17:80949750-80949772 GCTGAGACCATGCCCAGGGCTGG - Intronic
1152656244 17:81520310-81520332 GGTCACACCATGCCCAGGGAAGG + Intronic
1155062760 18:22243143-22243165 AGTCACTCCATGCCCAGTGCTGG + Intergenic
1156299505 18:35823893-35823915 AGATACACCATGCTCAGGGAAGG + Intergenic
1156462187 18:37327337-37327359 GGTCATACCAGGACCAGGAAAGG - Intronic
1157524842 18:48372932-48372954 GGCCCCAGCATGTCCAGGGAGGG - Intronic
1159534213 18:69694314-69694336 GAATAGACCATGCCCAGGGAAGG - Intronic
1160381330 18:78458348-78458370 CTTCACACCCTGCACAGGGAGGG - Intergenic
1161306580 19:3572486-3572508 GGTCCCACCTTGCCTAGGGCTGG + Intronic
1161338874 19:3729946-3729968 GGGCACCCCCTCCCCAGGGAGGG + Intronic
1161851580 19:6740319-6740341 GCTCACCCCAGGCCCAGGGCGGG + Intronic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1163603993 19:18264376-18264398 GGTCTCACGGGGCCCAGGGAGGG + Exonic
1163726927 19:18928296-18928318 GCTCAGACCAGGCCCTGGGAGGG - Exonic
1166759499 19:45215824-45215846 GGTCACAGGAAGCCCAGGGCAGG - Intronic
1166946425 19:46399818-46399840 GGTCGCACAATGCCCAAGGATGG - Intergenic
1167564570 19:50248392-50248414 GCTCACACCATGAGCAGGGAGGG + Intronic
1167722015 19:51185664-51185686 GGTCACACCAGCCTCAGGCAGGG - Intergenic
1167762310 19:51457492-51457514 GGTCACACCTGTCCCAGGCAAGG + Exonic
925090699 2:1153531-1153553 AGTCATCTCATGCCCAGGGATGG + Intronic
928099932 2:28431066-28431088 GGTCACCAAATGCCCAGGGTTGG - Intergenic
929618128 2:43328338-43328360 CGTCACACCTCCCCCAGGGAGGG - Intronic
929658627 2:43759539-43759561 AGACCCACCCTGCCCAGGGATGG + Intronic
930269560 2:49240435-49240457 GCTTACTCCATGACCAGGGATGG - Intergenic
931756291 2:65377618-65377640 GGTCAGACGATGACCAGGAAAGG - Intronic
931781032 2:65579631-65579653 GCTCACACCATGGTCAGGGCTGG - Intergenic
932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG + Intronic
934323685 2:91986825-91986847 GGTAAAAACATGGCCAGGGAGGG - Intergenic
937244989 2:120486769-120486791 GCTCAAGCCAGGCCCAGGGAAGG - Intergenic
938039096 2:128061000-128061022 GGTCCCACATTTCCCAGGGAAGG + Intergenic
938108594 2:128549780-128549802 GGTCACACCAGCCCCAGGGTGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947700121 2:232226773-232226795 GGTCTCACTATGCCCAGGCTGGG - Intronic
948122682 2:235543054-235543076 GGTCGCACAATACCCAGGGAGGG - Intronic
948370559 2:237486946-237486968 GGTCCCACCGTGCCCAAGGCAGG + Intronic
948674404 2:239588587-239588609 TGCCACACCAGCCCCAGGGAAGG - Intergenic
949021139 2:241742121-241742143 GTTCACACCATGCTCACAGAGGG - Intronic
1169539291 20:6581749-6581771 GGTCACAGAATGCTCAGGTATGG - Intergenic
1170567916 20:17617087-17617109 GGTCACCTCACTCCCAGGGAGGG - Intronic
1171375932 20:24694168-24694190 GGACACACCATGGCCAGGAGGGG + Intergenic
1172221220 20:33276423-33276445 GTTAACACCATGCTCAGGGCAGG + Intronic
1174175084 20:48639588-48639610 AGTCACATCCTGCCCAGGGCAGG + Intronic
1174819071 20:53711867-53711889 TGTCAGACCAAGCCCCGGGAAGG - Intergenic
1176416078 21:6475447-6475469 GGTCAGACCATGGACAGGGATGG + Intergenic
1179567777 21:42260011-42260033 GGTCAGTCCAAGTCCAGGGAGGG + Intronic
1179691578 21:43083781-43083803 GGTCAGACCATGGACAGGGATGG + Intergenic
1183237316 22:36629317-36629339 GCTCACAGCCTGCCCAGGGAAGG - Intronic
1183285702 22:36961512-36961534 GGTCACAGGAGGACCAGGGATGG - Intergenic
1184286137 22:43472739-43472761 GGTCCCAGCCTGGCCAGGGAGGG - Intronic
1184411156 22:44327300-44327322 CGTCAGACCAGGCCCAGGCAGGG - Intergenic
1184420579 22:44380755-44380777 GGTCACACGGGGCCCTGGGAGGG + Intergenic
1184610046 22:45597588-45597610 GGGCAGACCCAGCCCAGGGAGGG + Intronic
1184685314 22:46094185-46094207 AGTCCCACCATGCCCAGGCAAGG + Intronic
1185213582 22:49585969-49585991 GGTCAGCCCCGGCCCAGGGATGG - Intronic
949438981 3:4060027-4060049 GGTCAAACCATGCCAAGTGGAGG + Intronic
952729030 3:36619695-36619717 GGTCACACCAAGCCGAGAGTAGG - Intergenic
954456511 3:50602587-50602609 AGACACAGCAGGCCCAGGGAAGG - Intergenic
954577663 3:51685701-51685723 AGTCCCACCCTGCCCAGAGATGG - Intronic
958750208 3:98186578-98186600 GTTCAGCCTATGCCCAGGGATGG - Intronic
961000488 3:123370896-123370918 GGGCACACAAAGCCAAGGGAAGG + Intronic
964961824 3:162437157-162437179 GTTCAGCCTATGCCCAGGGATGG - Intergenic
964961857 3:162437362-162437384 GTTCAGCCTATGCCCAGGGATGG - Intergenic
966222660 3:177566085-177566107 GTTAACAGGATGCCCAGGGAGGG - Intergenic
968660830 4:1798106-1798128 GGACACACCATGGGCAGGGCTGG - Intronic
968698739 4:2044845-2044867 GGTCACTGCAGGCCCAGGCAGGG + Intergenic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
972104056 4:35461093-35461115 GGTTACAGCAGGCCCAGGGCAGG - Intergenic
972204903 4:36759897-36759919 GTTTACACAGTGCCCAGGGAAGG + Intergenic
972215954 4:36896915-36896937 GTTCAGCCTATGCCCAGGGATGG + Intergenic
972237825 4:37154451-37154473 TGTCAGACCATGGCCAGAGAGGG + Intergenic
972976270 4:44640532-44640554 GGTCCCACCCTTCCCATGGAAGG - Intronic
973724068 4:53754647-53754669 CCTCATACCTTGCCCAGGGACGG + Intronic
974737145 4:65951369-65951391 GATCAGACCATGCCCAAAGAAGG + Intergenic
976223688 4:82778559-82778581 GGCCAGACCATCCCCAGGGAGGG + Intronic
979169721 4:117585356-117585378 GGTGACAACATGCTCAGTGAAGG + Intergenic
979422674 4:120525575-120525597 GGTAACAGGATGTCCAGGGAAGG + Intergenic
985763288 5:1762887-1762909 GGTCACACCCTGGCCTGGCAAGG + Intergenic
986265786 5:6189289-6189311 TTTCACACCATGCCCTGGAAGGG + Intergenic
989732438 5:44664606-44664628 GGTACCAACAAGCCCAGGGAGGG + Intergenic
990357529 5:54985170-54985192 GCTCTCAGCATGCCCCGGGAGGG + Intronic
992269464 5:75051122-75051144 GCACACACCATTCCCGGGGATGG + Intergenic
993344946 5:86771098-86771120 TGTCACACCATGCCCACATAAGG - Intergenic
997791870 5:136769163-136769185 GGCCACACCAGGACCAGGGCAGG + Intergenic
998031585 5:138874457-138874479 GGACACGCCATACCCAGGGCAGG + Exonic
998404759 5:141867994-141868016 GGGCACCCCATGCCTAGGGGAGG + Intronic
999782003 5:154857584-154857606 GGCCACACGCTGCCCAGGGCCGG + Intronic
1002131116 5:177082214-177082236 GGAGACACCAGGCCCAGGCAGGG - Intergenic
1006601905 6:35231859-35231881 GGTCAGCCCATGACCTGGGATGG + Exonic
1006606288 6:35259863-35259885 GGGCCAACCATGCCCAGGGCGGG + Intronic
1007112758 6:39322527-39322549 GGCCACAGCATGCCCAGTGCTGG - Exonic
1007913175 6:45536219-45536241 GGGCTGACCATGCCCTGGGAGGG - Intronic
1008426166 6:51359430-51359452 CATCACACCATGCCCAAGTAAGG - Intergenic
1009464065 6:63950371-63950393 GGTCACAACATGCTCAGTGGGGG - Intronic
1010389860 6:75324458-75324480 GCACACCCCATGCTCAGGGACGG + Intronic
1012143287 6:95650314-95650336 CTTCACACCATGCACAGTGAGGG + Intergenic
1015576398 6:134676252-134676274 GGTCTCCTGATGCCCAGGGAAGG + Intergenic
1018529486 6:164747642-164747664 GGGCACACCAGGCCCAGCCATGG - Intergenic
1019300784 7:302462-302484 GGCCACACCTGGCCCTGGGATGG - Intergenic
1019750607 7:2726797-2726819 GGTCACACCACGCCGAGGACCGG + Intronic
1019894782 7:3975356-3975378 TGTCAAACGATGACCAGGGACGG - Intronic
1019937289 7:4264912-4264934 GGTCACACCTGGATCAGGGAGGG + Intronic
1021579913 7:22141705-22141727 GGACAGACCATGCCCAGTGGAGG - Intronic
1022164286 7:27742095-27742117 AGACATTCCATGCCCAGGGACGG + Intronic
1024007975 7:45241441-45241463 GGCCACACCCTGCCCAAGGGCGG + Intergenic
1032257563 7:130309328-130309350 GCTCACAACTTGCCCAGGCAGGG - Intronic
1032844366 7:135739986-135740008 CGCCAGACCATGCTCAGGGAAGG + Intronic
1033623545 7:143085527-143085549 GGTCACACCTTGGCCAGGCATGG + Intergenic
1033629778 7:143146335-143146357 GGTGACAGCAAGACCAGGGAGGG - Intergenic
1034759640 7:153659273-153659295 GTGCAAACCAAGCCCAGGGAGGG - Intergenic
1035048267 7:155983342-155983364 GGCCAAACCCTGCCCAGGGTGGG + Intergenic
1035056933 7:156041893-156041915 GGTTACAGCATGCCCAGGACGGG - Intergenic
1037991823 8:23326772-23326794 GAGCTCACCATGCCCAGGGAAGG + Intronic
1039224678 8:35375512-35375534 GTTCAGACCATGCTCAGTGATGG + Intronic
1043573414 8:81630500-81630522 GGTCACACCCTTCCCAGCGTGGG + Intergenic
1044078471 8:87854673-87854695 GATCACTGCTTGCCCAGGGAAGG + Intergenic
1047677861 8:127222617-127222639 GGTCACAGGATACCCAGGGAAGG + Intergenic
1047746501 8:127848923-127848945 GTCCACACCATGCCCTGGGGAGG - Intergenic
1047758604 8:127937492-127937514 GGTGGCACCCTGCCCAAGGAGGG - Intergenic
1049108943 8:140630903-140630925 TGTGCCACCATGCCCAGCGAAGG - Intronic
1049224190 8:141441829-141441851 GGCCACCCCCTGCCCTGGGAAGG + Intergenic
1049593768 8:143474201-143474223 GGTGACACAGTGCCCAGGAAGGG + Intronic
1049613143 8:143565083-143565105 GGACACAGCATCCCCATGGAGGG + Intergenic
1049663373 8:143830496-143830518 GGTCAGACCCAGCCCAGGGGTGG - Intergenic
1049813448 8:144586698-144586720 GCTCAGAGCCTGCCCAGGGAAGG + Intronic
1051294291 9:15578558-15578580 AGTCACACCTTGGCCAGGCACGG - Intronic
1053442292 9:38126431-38126453 GCACACTCCATGCACAGGGATGG - Intergenic
1057179498 9:93022139-93022161 GCTCAGGCCAGGCCCAGGGAGGG + Intronic
1057252295 9:93513814-93513836 GGTCTCACCACGCCCAGTGTTGG + Intronic
1060265629 9:122110152-122110174 GGTTATACCGTGCCCTGGGAGGG - Intergenic
1060355548 9:122904634-122904656 GGCCAAACAATGCCCTGGGAGGG - Intronic
1060454451 9:123778706-123778728 GGTCACATCCTGCCCGGGGCTGG - Intronic
1061682577 9:132250284-132250306 GGTCTCCCCATGCCCAAGAAAGG + Intergenic
1061995369 9:134180395-134180417 GGTCACAGGATCCCCAGGGGAGG - Intergenic
1062261559 9:135665554-135665576 GGTCACGCCCTGACCAGAGAGGG - Intronic
1188159522 X:26783194-26783216 GTTCAGCCTATGCCCAGGGATGG - Intergenic
1191812624 X:65206030-65206052 GGAAACACCATGCTCATGGATGG + Intergenic
1195671069 X:107470634-107470656 GTTCAGACCATGCTCAGGGGAGG + Intergenic
1198436191 X:136618986-136619008 GTGGACACCATGCCCAGAGATGG - Intergenic