ID: 1152656804

View in Genome Browser
Species Human (GRCh38)
Location 17:81523633-81523655
Sequence GTGGAGTACCTGGGAATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152656792_1152656804 13 Left 1152656792 17:81523597-81523619 CCTAGGCAGGGGCTTGGCACGGG 0: 1
1: 0
2: 3
3: 41
4: 292
Right 1152656804 17:81523633-81523655 GTGGAGTACCTGGGAATCACTGG 0: 1
1: 0
2: 1
3: 14
4: 156
1152656785_1152656804 30 Left 1152656785 17:81523580-81523602 CCAAGGGGACAACAGAGCCTAGG 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1152656804 17:81523633-81523655 GTGGAGTACCTGGGAATCACTGG 0: 1
1: 0
2: 1
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152656804 Original CRISPR GTGGAGTACCTGGGAATCAC TGG Intronic
903787747 1:25872635-25872657 CTTGAGTAGTTGGGAATCACAGG + Intergenic
906321870 1:44822355-44822377 GTGGGGTCACTGGGAAGCACTGG - Exonic
908973070 1:69861816-69861838 GTGGCGGACCTGGAAATCACAGG + Intronic
911223674 1:95279466-95279488 GTGGTGTTAATGGGAATCACTGG + Intergenic
917086408 1:171309199-171309221 TGGGAGTTCCTTGGAATCACCGG + Intergenic
920792309 1:209104782-209104804 GTGAAGTGCCTGGTAATCAAGGG + Intergenic
920983105 1:210856728-210856750 GAGGAGCACATTGGAATCACCGG + Intronic
921179312 1:212619253-212619275 GGGGTGTACCTGGGACACACCGG - Intronic
922588960 1:226758604-226758626 CTGGAGTAGCTGGGACTTACAGG - Intergenic
922765178 1:228152740-228152762 GTGGAGGGCCGGGGACTCACAGG - Intronic
1063299327 10:4837462-4837484 ATGGAGGACCTGGTGATCACCGG + Exonic
1063410263 10:5831834-5831856 CTGGAGTAGCTGGGAATAACAGG + Intronic
1068273863 10:54766803-54766825 CTGGAGTAGCTGGGACTTACAGG - Intronic
1069793000 10:71035269-71035291 GTGGAAGAGGTGGGAATCACTGG + Intergenic
1071228729 10:83561910-83561932 TTGGAATACCTGGGGATCCCTGG - Intergenic
1072616101 10:97049670-97049692 CTGGAGTCCCTGGGCTTCACAGG + Intronic
1073262096 10:102198220-102198242 ATGGAATACCTAGGAATAACTGG - Intergenic
1074069726 10:110054564-110054586 GCGGAGTAGCTGGGATTTACAGG + Intronic
1077141082 11:1025173-1025195 GTGCGGTACCTGGGAGGCACGGG + Exonic
1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG + Intergenic
1083309415 11:61776773-61776795 ATGAAGTACCTGGGACACACAGG - Exonic
1084647294 11:70465874-70465896 ATGGAGGACCTGGGAAGGACTGG + Intergenic
1087370686 11:97279897-97279919 GTGTACTCCCTGGGTATCACTGG - Intergenic
1088117639 11:106330690-106330712 ATGTAGTACCTGGGGATCAGAGG + Intergenic
1093174090 12:15891819-15891841 CCTGAGTACCTGGGAATTACAGG - Intronic
1101904793 12:108816563-108816585 ATGAAGTACTTGGGAATCAGTGG + Intronic
1102462432 12:113108197-113108219 GTGAAGTACCTGGCCATCAGTGG - Exonic
1107584728 13:41832273-41832295 GTTGAGAACCTGAGAAGCACTGG + Intronic
1108848900 13:54704590-54704612 GTGGGGTTCCTTGGAATCACCGG + Intergenic
1109865310 13:68256932-68256954 GTGCGGAACCTGGGATTCACAGG + Intergenic
1110906489 13:80896878-80896900 CGGGAGTTCCTTGGAATCACGGG + Intergenic
1111085970 13:83375110-83375132 AAGTAGTACTTGGGAATCACAGG + Intergenic
1113177844 13:107586409-107586431 TTGGAGTCCCAGTGAATCACAGG - Intronic
1119989359 14:79178078-79178100 GTGTAGTACATAGGCATCACTGG + Intronic
1120301443 14:82712475-82712497 GTGTAGTACCTGGGCATCATAGG - Intergenic
1120795221 14:88625012-88625034 GTGGTGTACATGGCAAACACAGG + Exonic
1122125519 14:99576562-99576584 GTGGACTCCCTGGGCCTCACAGG - Intronic
1125194133 15:37027386-37027408 GTGGAGTGATTGGGAATTACAGG - Intronic
1128649658 15:69401223-69401245 GGTGAGTACATGGGAATCAAAGG + Intronic
1130010916 15:80152677-80152699 GTGGAGGACCTGGGGCTCGCGGG + Intronic
1131237087 15:90706091-90706113 CTGGAGTAGCTGGGACTAACAGG + Intergenic
1134467829 16:14494923-14494945 TTGAAGTACCTGGGAAACATCGG + Intronic
1138443635 16:57049950-57049972 GTGGAACCCCGGGGAATCACTGG - Intronic
1139672863 16:68503599-68503621 GTGAAGTGCCTGGGAAAGACAGG - Intergenic
1141737031 16:85860736-85860758 GTGGAGTGCCTGAGGATCAGTGG + Intergenic
1142223483 16:88866318-88866340 GTGGAGGCCCTGGGGATCTCAGG - Intronic
1143251780 17:5528194-5528216 ATAGAGTACCTGGGGATCCCTGG + Intronic
1143570799 17:7756999-7757021 GTGGAGAGGCTGGGAAGCACAGG - Intronic
1143861758 17:9896593-9896615 ATGGAGTTCCTGGGTATCCCAGG + Exonic
1144515116 17:15912087-15912109 CCTGAGTAGCTGGGAATCACAGG - Intergenic
1144851352 17:18245652-18245674 TTGGAGCACCTGGGAATCAAGGG + Exonic
1147346752 17:39802659-39802681 GTAGAATACCTGGGAATAGCTGG + Intronic
1148077238 17:44945183-44945205 CCTGAGTAGCTGGGAATCACAGG + Intronic
1148704313 17:49615636-49615658 CAGGAGTAGCTGGGAACCACAGG + Intronic
1152656804 17:81523633-81523655 GTGGAGTACCTGGGAATCACTGG + Intronic
1155040069 18:22057499-22057521 CCCGAGTAGCTGGGAATCACAGG - Intergenic
1155439546 18:25847527-25847549 GTGGAGCAACTGGGAAGGACTGG - Intergenic
1156683949 18:39621824-39621846 CAGGAGTACGAGGGAATCACAGG - Intergenic
1157654391 18:49370640-49370662 CCCGAGTAGCTGGGAATCACAGG - Intronic
1157925809 18:51765009-51765031 CTGGAGTTCCAGGGAAACACTGG + Intergenic
1158199453 18:54923834-54923856 CTTGAGTAGCTGGGAATTACAGG + Intronic
1158765484 18:60445937-60445959 TTGGAGTACCTGAAAAACACAGG - Intergenic
1160338489 18:78065187-78065209 CTCGAGTACCTGGGACTTACAGG - Intergenic
1160848507 19:1177931-1177953 GGGGATTTCCAGGGAATCACAGG + Intronic
1160868689 19:1267237-1267259 GTGAGATACCTGGGAGTCACGGG + Intronic
1163433098 19:17280010-17280032 CTCAAGTAGCTGGGAATCACAGG - Intronic
1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG + Intergenic
1168141685 19:54392331-54392353 GTGGAGTCCCTGGAACTCAGCGG + Intergenic
1168531153 19:57130435-57130457 GGGTAGAACCAGGGAATCACTGG - Exonic
927177966 2:20423565-20423587 GGGCAGTGCCTGGGAATCCCAGG - Intergenic
927369560 2:22338897-22338919 GGAGAGTACCTGGGAATACCAGG - Intergenic
928333330 2:30374557-30374579 GTGGAGCACCAGGGAAGCAATGG + Intergenic
929163742 2:38859933-38859955 CTTGAGTACCTGGGACTCAGAGG + Intronic
936496735 2:113028997-113029019 ATGGTTTACCTGGGAATCAAGGG - Exonic
937917901 2:127107879-127107901 GTGGAGCACCTGGGAGACAGAGG - Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
942897479 2:181074739-181074761 GTGAATTATCTGAGAATCACTGG + Intronic
947727796 2:232410535-232410557 GAGGAGCACCTGGGAAGCTCTGG + Exonic
947931435 2:233968285-233968307 GAGGTGAACCTGGGAAGCACAGG + Intronic
1169097772 20:2918272-2918294 CTGGAGTAGCTGGGCATTACAGG + Intronic
1169496067 20:6116602-6116624 CTGGAGTAGCTGGGATTAACAGG - Intronic
1170665399 20:18381931-18381953 CTAGAGTATCTGGGAATTACAGG - Intergenic
1171397760 20:24849292-24849314 TTGGAGTACCTGAAAATGACTGG - Intergenic
1171805981 20:29680646-29680668 GGGGAGTTCCTTGGAAGCACAGG + Intergenic
1173605433 20:44327679-44327701 CCTGAGTAGCTGGGAATCACAGG + Intergenic
1173607721 20:44343496-44343518 GAGGAGTACCTGGGTATAATGGG - Exonic
1175135909 20:56823838-56823860 GTGGAGTACATGGGAACTCCCGG + Intergenic
1175327879 20:58142259-58142281 CTTGAGTTCCTGGGGATCACAGG - Intergenic
1175421999 20:58840545-58840567 GTGGAGTGCTTGGGCACCACCGG - Intronic
1175580863 20:60098045-60098067 CTGTAGTCCCTGGCAATCACTGG + Intergenic
1177246691 21:18534625-18534647 CTTGAGTACCTGGGACTTACAGG + Intergenic
1177799417 21:25813126-25813148 GTGGAGTAACTGGGACTTTCAGG + Intergenic
1178317760 21:31581031-31581053 GTGGAGTACCTGGGAAGCTGAGG + Intergenic
1180213416 21:46309870-46309892 CTGGAGTAGCTGGGGATTACAGG - Intronic
1181362772 22:22351405-22351427 GTGGAGAACATGGAAAACACAGG + Intergenic
1181365533 22:22374187-22374209 GTGGAGAACATGGAAAACACAGG + Intergenic
1181430531 22:22878911-22878933 GAGCAGGACCTGGGAATCACAGG + Intronic
1183961274 22:41413304-41413326 GCCGAGTAGCTGGGAATTACAGG - Intergenic
1184394597 22:44225661-44225683 GAGGCGTACATGGGAGTCACTGG - Intergenic
1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG + Intronic
1184675713 22:46041911-46041933 CTGGAGTAGCTGGGAGTTACAGG + Intergenic
950912209 3:16605987-16606009 CTGCTGTACCTGGTAATCACAGG - Intronic
951423097 3:22510749-22510771 ACGTAGTACCTGGGTATCACTGG - Intergenic
951676734 3:25250057-25250079 GTGGACTCCCTGGGAGTCAGAGG - Intronic
952248769 3:31628237-31628259 GTGGAGTCCCTGGTAATCACTGG + Intronic
953561765 3:43997906-43997928 GTGGAGTACCAAAGAATCAAGGG + Intergenic
954435900 3:50495887-50495909 GTGGAGGACTTGGGACTCAGAGG - Intronic
955854175 3:63255422-63255444 GTGTAGTACCTTGGCATAACTGG - Intronic
961109092 3:124268593-124268615 GTGGAGGCCATGGGACTCACTGG - Intronic
961198124 3:125020868-125020890 GTAGAGTAACTGGGAATCCAGGG - Exonic
963296026 3:143547657-143547679 GTAGAGAAACTGGGAATGACAGG - Intronic
963738377 3:149048155-149048177 TTGGAGTACCTAGAAATAACAGG + Exonic
965026146 3:163304001-163304023 ATGTAGTACCTGGGAATACCTGG - Intergenic
971094842 4:23389044-23389066 GGGGAGGACCTGAGATTCACAGG + Intergenic
971560933 4:28078806-28078828 CTGGTGTACCTGAGAATCATGGG + Intergenic
972058857 4:34840608-34840630 CTGGAGTAGCTGGGACTAACAGG + Intergenic
973378634 4:49304708-49304730 GGAGAGTAGCTGGGAAACACAGG + Intergenic
973379584 4:49310946-49310968 GGAGAGTAGCTGGGAAACACAGG - Intergenic
976478350 4:85510624-85510646 CTGGAGAACCTGGGAAGGACAGG - Intronic
979361594 4:119771750-119771772 GTGGAGTAAATGAGGATCACAGG + Intergenic
984123569 4:175776810-175776832 GTGGAGTTCCTGGGAACAAAGGG + Intronic
985354946 4:189108706-189108728 TTGGAGTAGCTGGGGATCATGGG + Intergenic
990261333 5:54026391-54026413 CCTGAGTACCTGGGAATTACAGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
996680490 5:126224534-126224556 GGGGGGTTCCTTGGAATCACTGG + Intergenic
999406599 5:151312407-151312429 ATGTAGTATCTGGGTATCACTGG + Intergenic
1001539929 5:172530654-172530676 GAGGAGTACGTGGGAAGCATTGG - Intergenic
1002306966 5:178289284-178289306 GTGGATTAACTGGGATTTACCGG + Intronic
1002420345 5:179143307-179143329 TCCGAGTAGCTGGGAATCACAGG - Intronic
1003409705 6:5851495-5851517 GGGGAGCACCTGGGAAGCGCTGG + Intergenic
1008386831 6:50901483-50901505 CTTGAGTAGCTGGGATTCACAGG + Intergenic
1010711633 6:79181891-79181913 CTGGAGTAGCTGGGATTTACAGG + Intergenic
1011195271 6:84774059-84774081 GTGGAGTACCTGGGCAGCTCCGG + Intergenic
1013777835 6:113698773-113698795 GTTGGGTACTTGGGAAGCACTGG + Intergenic
1014170669 6:118275560-118275582 GTGGAATTCCTGGGAATGATTGG + Exonic
1019373211 7:674389-674411 ATGGAGTAGCTGGGCATGACTGG - Intronic
1019647031 7:2136426-2136448 GTGGAGTGCCTGGTACCCACAGG + Intronic
1019828800 7:3305201-3305223 GAGGTGTACATCGGAATCACTGG + Intronic
1019863531 7:3683592-3683614 GTGGAGGACCTGGGAGGAACGGG - Intronic
1023651300 7:42371812-42371834 CCTGAGTAGCTGGGAATCACAGG - Intergenic
1023788655 7:43734521-43734543 TTGGAGTAGCTGGGGATTACAGG + Intergenic
1024502970 7:50132936-50132958 GTGGAGGAAGTGAGAATCACTGG + Intronic
1030599741 7:111580245-111580267 GTAGAGTACCAGGAAATCCCTGG - Intergenic
1030617205 7:111750531-111750553 GTGGAGTCCCTGAGGTTCACAGG - Intronic
1034970080 7:155413325-155413347 GTGTAGTAGCTGGGCATCAATGG + Intergenic
1039441345 8:37597561-37597583 CTGGACTTCCTGGGAATCCCAGG + Intergenic
1041647678 8:60270338-60270360 GTGGTGTACCAGGGACCCACTGG - Intronic
1042019004 8:64349784-64349806 GTGGAGTAGCTGTGAATTATAGG + Intergenic
1042880624 8:73484725-73484747 GTGGCAGAACTGGGAATCACAGG - Intronic
1044740214 8:95318656-95318678 CTGGAGAACCAGGAAATCACTGG - Intergenic
1047193006 8:122695639-122695661 CTGGAGTAGCTGGGATTTACAGG + Intergenic
1047966838 8:130051238-130051260 CCCGAGTAGCTGGGAATCACAGG + Intergenic
1051399367 9:16663097-16663119 GTGGAGTGCCTATGGATCACTGG - Intronic
1056069328 9:82969522-82969544 GTGAAGTAGCTGGTAATCAGGGG - Intergenic
1060568549 9:124616276-124616298 GTGGAGTAGCTTGGGATTACAGG - Intronic
1060598981 9:124865463-124865485 GTAGAGTACCTGGAATTTACTGG - Intronic
1186125067 X:6404582-6404604 GTGGGCTACATGGGACTCACTGG - Intergenic
1190178279 X:48169296-48169318 CTGCAGTACCTGGGATTCACAGG - Intergenic
1191607653 X:63079724-63079746 TTGGGGTACCTGGTAAGCACTGG + Intergenic
1192407608 X:70902124-70902146 CTTGAGTAGCCGGGAATCACAGG - Intronic
1192482500 X:71497846-71497868 GTGGGGTTCCTTGGAATCACTGG - Intronic
1192988689 X:76428076-76428098 CTGGAGGATCTGGGAATCGCTGG - Exonic
1193192350 X:78586185-78586207 CTGGAGTAGCTGGGACTTACAGG + Intergenic
1194391994 X:93330371-93330393 CTTGAGTAGCTGGGATTCACAGG + Intergenic
1194457422 X:94122641-94122663 CCTGAGTAGCTGGGAATCACAGG + Intergenic
1194493278 X:94577862-94577884 GTGTACTACCTGGATATCACTGG - Intergenic
1195388608 X:104337480-104337502 CTGGAGTAGCTGGGACTTACAGG - Intergenic
1197255470 X:124258283-124258305 GAGGTGTACCTGGGGATCATGGG + Intronic
1202282039 Y:23199551-23199573 CTGCAGTACCTGGTAATCACAGG - Intergenic
1202283852 Y:23218968-23218990 CTGCAGTACCTGGTAATCACAGG + Intergenic
1202433711 Y:24813936-24813958 CTGCAGTACCTGGTAATCACAGG - Intergenic
1202435528 Y:24833354-24833376 CTGCAGTACCTGGTAATCACAGG + Intergenic