ID: 1152656918

View in Genome Browser
Species Human (GRCh38)
Location 17:81524089-81524111
Sequence CTTTCTGAGGTGCTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152656918_1152656932 25 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656932 17:81524137-81524159 GAAACCTGAGGGTGGACACCAGG No data
1152656918_1152656931 17 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656931 17:81524129-81524151 GCTCTCGGGAAACCTGAGGGTGG No data
1152656918_1152656925 -5 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656925 17:81524107-81524129 GAAAGGGAACGATTTCCTAAGGG No data
1152656918_1152656927 3 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656927 17:81524115-81524137 ACGATTTCCTAAGGGCTCTCGGG No data
1152656918_1152656929 13 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656929 17:81524125-81524147 AAGGGCTCTCGGGAAACCTGAGG No data
1152656918_1152656926 2 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656926 17:81524114-81524136 AACGATTTCCTAAGGGCTCTCGG No data
1152656918_1152656924 -6 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656924 17:81524106-81524128 AGAAAGGGAACGATTTCCTAAGG No data
1152656918_1152656930 14 Left 1152656918 17:81524089-81524111 CCGTCCACCAGCACCTCAGAAAG No data
Right 1152656930 17:81524126-81524148 AGGGCTCTCGGGAAACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152656918 Original CRISPR CTTTCTGAGGTGCTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr