ID: 1152659169

View in Genome Browser
Species Human (GRCh38)
Location 17:81534538-81534560
Sequence TCTCCCAGGACCCCTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 402}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152659169_1152659180 10 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659180 17:81534571-81534593 ATGGTTGGGGAAAGCTGCAGAGG 0: 1
1: 0
2: 1
3: 25
4: 274
1152659169_1152659176 -5 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659176 17:81534556-81534578 GGAGACCAAGCACAGATGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 163
1152659169_1152659183 30 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659183 17:81534591-81534613 AGGTGACAGGGACCAGCCCCTGG 0: 1
1: 0
2: 0
3: 24
4: 307
1152659169_1152659178 -3 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659178 17:81534558-81534580 AGACCAAGCACAGATGGTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 146
1152659169_1152659181 17 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659181 17:81534578-81534600 GGGAAAGCTGCAGAGGTGACAGG 0: 1
1: 1
2: 3
3: 33
4: 401
1152659169_1152659177 -4 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659177 17:81534557-81534579 GAGACCAAGCACAGATGGTTGGG 0: 1
1: 0
2: 1
3: 11
4: 151
1152659169_1152659175 -9 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659175 17:81534552-81534574 CCTGGGAGACCAAGCACAGATGG 0: 1
1: 0
2: 2
3: 33
4: 277
1152659169_1152659182 18 Left 1152659169 17:81534538-81534560 CCTCCCCCAGGGGTCCTGGGAGA 0: 1
1: 0
2: 4
3: 50
4: 402
Right 1152659182 17:81534579-81534601 GGAAAGCTGCAGAGGTGACAGGG 0: 2
1: 0
2: 5
3: 31
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152659169 Original CRISPR TCTCCCAGGACCCCTGGGGG AGG (reversed) Intronic
900099003 1:953006-953028 TCTCACAGAGCACCTGGGGGTGG - Intronic
900330693 1:2133153-2133175 TTTCCCAGGCGCACTGGGGGTGG + Intronic
900357476 1:2271704-2271726 TGGCCCTGGTCCCCTGGGGGGGG + Intronic
900531309 1:3154768-3154790 TCTACCAGGAACCCTGGGTCAGG + Intronic
900538514 1:3190987-3191009 TCCCGCAGGACCCCCAGGGGAGG + Intronic
900547335 1:3236238-3236260 TCTCCCACAGCCCCTGGGGCTGG + Intronic
900568245 1:3345904-3345926 GCTCCCAGGAGCCCAGGGTGGGG - Intronic
900585701 1:3431310-3431332 GCCTCCAGGGCCCCTGGGGGTGG - Intronic
901026412 1:6280848-6280870 ACTCCCAGGGCCCGTGGGGTGGG - Intronic
901412002 1:9090754-9090776 TGTCCCTAAACCCCTGGGGGAGG - Intergenic
901493966 1:9610820-9610842 CCTCCCACGGCCCCTTGGGGTGG - Intronic
901678949 1:10902150-10902172 TCTCCCAACAGCCCTGTGGGAGG + Intergenic
902124169 1:14194549-14194571 TCTCCCAGCAGTCCTTGGGGAGG + Intergenic
902405998 1:16183973-16183995 TCTCCCAGGGCCTGTGGGGAAGG - Intergenic
902717627 1:18283400-18283422 TCCCCCAGGCCCCCTTGGGGAGG + Intronic
902779908 1:18698461-18698483 TCTCCCAGGCCTCCTGGGCATGG - Intronic
902833516 1:19032973-19032995 TCTCCCAGCACCCCTCCTGGAGG - Intergenic
903264018 1:22145742-22145764 TCTCCCAGCACCCCAGGAGAAGG - Intergenic
904094446 1:27966400-27966422 CCTCCCAGCAACCCTGGGGTAGG - Intronic
904237305 1:29123752-29123774 TCGGTCAGGGCCCCTGGGGGCGG - Intronic
904253708 1:29241313-29241335 TATCCCAGCATCCCTGGGGCTGG + Intronic
904379173 1:30099839-30099861 TTTTCCAGGACTCCTGGAGGGGG + Intergenic
904537331 1:31208532-31208554 CTTCACAGCACCCCTGGGGGTGG + Intronic
905232464 1:36522721-36522743 TCTGCCAGGTCTCCTGGTGGTGG + Intergenic
905853311 1:41290307-41290329 TCTCCCTAGACCCATGGGGCTGG - Intergenic
906700185 1:47852136-47852158 TCCCCCAGGGCCCATGGCGGTGG - Intronic
907571163 1:55485240-55485262 TCTTCCTTGAGCCCTGGGGGTGG + Intergenic
910142238 1:84038500-84038522 TCTCACAGGAGTCCTTGGGGAGG - Intergenic
910849261 1:91635114-91635136 TCTCCTAGTACCCCTTTGGGAGG - Intergenic
911057661 1:93722102-93722124 TCGGCCAGGTCCCATGGGGGAGG + Intronic
912452045 1:109773269-109773291 TCTCCCAGCTGCCCTGGGGCTGG - Intronic
912520440 1:110241030-110241052 GCTCCCAGGGCGCCTGGGGGCGG + Intronic
916195638 1:162219658-162219680 TCTCCCTAGAACCCTGGTGGGGG - Intronic
916726276 1:167526671-167526693 TCTCCCAAGACCCCTGTGAGGGG + Intergenic
917835463 1:178938461-178938483 TCTGCCAGGACCACTGCAGGGGG - Intergenic
917977947 1:180252100-180252122 AGTCCCAAGACCCCTGGGGATGG - Intronic
919974336 1:202600878-202600900 TCCCCCAGGGCCCTTGGTGGTGG - Intronic
920516963 1:206592405-206592427 CCTCCCAGGACCCCTGGGCTGGG + Intronic
920915636 1:210255965-210255987 CCTCACAGGACCCCTGGGGCAGG + Intergenic
922421247 1:225462325-225462347 TGTCCCAGGGCCCATGGTGGTGG + Intergenic
1062875889 10:942826-942848 CCTCCCTGCACCCCTGGGAGAGG + Intergenic
1063381323 10:5587974-5587996 TCTCTGAGGGCCCCTGGGTGAGG - Intergenic
1064932473 10:20642735-20642757 TTTCCCAGGACATCGGGGGGTGG - Intergenic
1066526388 10:36283972-36283994 TCTCCCTGGACCCATGTGGGAGG - Intergenic
1067655157 10:48186284-48186306 TCTGCCAAGGTCCCTGGGGGAGG - Intronic
1070334786 10:75445691-75445713 CCACTCAGGGCCCCTGGGGGAGG - Intronic
1070554505 10:77517351-77517373 CCTCTCAGGCCCCCTGGGCGTGG + Intronic
1071870631 10:89790127-89790149 TCTCACAGGAGTCCTTGGGGAGG - Intergenic
1072916460 10:99540289-99540311 ACTCCCAGGTCCCCGGGGTGAGG + Intergenic
1073491211 10:103854826-103854848 GCGCCCAGGGCCCCTGGGGAGGG + Intronic
1074486873 10:113893106-113893128 TCTCCCTGTACCCCTGGGAATGG - Intronic
1074773218 10:116746536-116746558 TGTCCCAGGTCCCCTGAGGTGGG - Intergenic
1074782174 10:116809931-116809953 TCGCACAGGATCCCTGGGGAGGG + Intergenic
1076369509 10:129942473-129942495 TCTTGCAGGACCACTGGGGCTGG - Intronic
1076739818 10:132477638-132477660 TCTCCTGGGGCCCCTGGAGGTGG - Intergenic
1076870247 10:133189419-133189441 GCTCCGAGGACCCCGGGGGCTGG + Intronic
1076991468 11:278302-278324 TCCCCAAGAACCCCTGGGTGTGG - Intergenic
1077210254 11:1367827-1367849 TCTGCCAGGACCCAGGGGTGGGG + Intergenic
1077415940 11:2424309-2424331 TGTCCTGGGACCCCTGGGGCTGG + Intergenic
1077489602 11:2854651-2854673 TCTCTCAGGTGCCCTGGGGCAGG + Intergenic
1077602456 11:3582817-3582839 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1078130593 11:8611101-8611123 TCTCCCAAGACTCCTGAGGTGGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081649833 11:44816527-44816549 CCTCCCAGCAACCCTGGGAGAGG + Intronic
1081703288 11:45165229-45165251 TCTCCCATGCCCCTTGGGAGTGG + Intronic
1082655956 11:55857277-55857299 ACTCCCAGGAGCCATGCGGGTGG - Intergenic
1082794626 11:57370221-57370243 CTTCCTAGGACCCCTGGGGCAGG + Exonic
1083298969 11:61730361-61730383 GCTCCCTGCAGCCCTGGGGGCGG - Intronic
1083617657 11:64034663-64034685 CCTCCCAGATCCCCTTGGGGAGG - Intronic
1083759386 11:64807394-64807416 TCTCCCAAGAGCCCTGGGAAAGG + Intronic
1083949680 11:65947143-65947165 TCTCCCAGGCCCACTGGAAGGGG - Exonic
1084258348 11:67957363-67957385 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1084718670 11:70890128-70890150 TGTCCCAGGCCCTTTGGGGGAGG - Intronic
1084860943 11:72017891-72017913 GCTCCCAGAACCCCAGGGGCTGG + Intronic
1086491761 11:87363041-87363063 TCTCCCCGGACGCTTGGAGGTGG + Intergenic
1088075639 11:105845323-105845345 TCTTCCTGGTCCCCTAGGGGTGG - Intronic
1088466632 11:110146991-110147013 TCTCCCAGGTCACCTCGCGGTGG + Intronic
1088526738 11:110763849-110763871 TAGCTCAGGACACCTGGGGGAGG - Intergenic
1089555738 11:119315251-119315273 TCTCCGGGCACACCTGGGGGAGG + Exonic
1090498661 11:127240209-127240231 TCTCCGATGGCCCATGGGGGTGG + Intergenic
1090904644 11:131064594-131064616 TACCCCAGGACCCTTGGGGCTGG - Intergenic
1091391609 12:129525-129547 TCCCCCAGGACTGCTGGGGTGGG - Intronic
1091490812 12:931079-931101 TCTCCCAGTGCCCCTGGGAGGGG - Intronic
1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG + Intronic
1091884297 12:4004629-4004651 TCTCCCAGGACCCCTTTGTTTGG - Intergenic
1093822000 12:23631894-23631916 CCTCCCAGGAACTCTAGGGGTGG + Intronic
1096782935 12:54001224-54001246 TCCCCCAGGAGCACTGGGTGAGG + Intronic
1096848633 12:54421276-54421298 CCTCCCAGGAGCCTTGGTGGGGG + Intergenic
1097303788 12:58046714-58046736 TCTCCTGGGACCCCTTGGGCTGG - Intergenic
1100664036 12:96730995-96731017 TCTCCCAGACCCCCTGGGCATGG + Intronic
1100676867 12:96878121-96878143 TCTCCCAGGACCATTGGTTGGGG - Intergenic
1101423262 12:104566498-104566520 TCTGCCAGGACCTGTGGGGATGG - Intronic
1102028751 12:109728036-109728058 TCCCCCAGTGCCCCTGGGGCGGG - Intronic
1103446803 12:121000117-121000139 GCTCCAATGACCCCTGGCGGTGG + Intronic
1106124218 13:26886914-26886936 TCTCCTAAGACCTCTGGGGGCGG + Intergenic
1108094040 13:46881443-46881465 TCTCTCTGGACCTCTGGGGAGGG + Intronic
1108524716 13:51276942-51276964 TCTGCCAGGGCTCCTGGGGGAGG + Intronic
1109284847 13:60397583-60397605 TCCCCTAGGTCCCCTGGAGGCGG + Intronic
1112565030 13:100545416-100545438 CGTCCCAGGGCCCCTGGAGGAGG + Intronic
1113923619 13:113928464-113928486 TCTCCCAGGACCCTTGGGCCTGG - Intergenic
1113955427 13:114097928-114097950 TCTCCCTGGACCCCCTGTGGTGG - Intronic
1114265081 14:21069187-21069209 TCTCCCAGGAGCCCGGGGGGAGG - Intronic
1116045077 14:39733721-39733743 TGTCCCTGAAACCCTGGGGGAGG - Intergenic
1118389971 14:65287635-65287657 GCTCCCAGGCCCCCAGAGGGCGG - Intergenic
1120210661 14:81630553-81630575 AGGCCCAGGACCCCTGGCGGTGG + Intergenic
1120865335 14:89291500-89291522 TCCCACAGGCCCCCTGGGGATGG - Intronic
1121042213 14:90758569-90758591 GCTCCCGCGACCCCTGGCGGCGG + Intronic
1122773206 14:104106266-104106288 TCTGCCAGGACCGCTGGGTGTGG + Intronic
1122833797 14:104421273-104421295 TACCCCAGGCTCCCTGGGGGTGG + Intergenic
1122954920 14:105066103-105066125 TGGCCCAGGAGCCCTGCGGGTGG + Intergenic
1124342563 15:28899634-28899656 TCTCCCAGTGCCTCTGTGGGAGG - Intronic
1124376739 15:29133358-29133380 TGACTCAGGAGCCCTGGGGGTGG + Intronic
1125478522 15:40063795-40063817 TCTCCCTGGCCCTCTGGGTGGGG + Intergenic
1129739766 15:77984629-77984651 AGACCCAGGACACCTGGGGGTGG - Intronic
1130176358 15:81575546-81575568 TCTCCAAGGAAACCTGGGGCTGG + Intergenic
1131255742 15:90860839-90860861 TCTCCCAGGACTTCAGGGAGAGG + Intergenic
1131286728 15:91065545-91065567 TCTCTCAGGCCCCATGGTGGAGG + Intergenic
1132204604 15:99977813-99977835 TCTCCCAGGAGCCCTTGGAATGG + Intronic
1132206889 15:99992646-99992668 ACTCCCGGGACCCCTGGGCAAGG - Intronic
1132611448 16:818337-818359 TCCCCCAGGCACCGTGGGGGCGG - Intergenic
1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG + Intergenic
1132748973 16:1448653-1448675 GCGCCCAGGACACCTGTGGGTGG - Intronic
1132760388 16:1506075-1506097 GCTCCCAGGCCCCATGGGGTTGG - Intronic
1132889797 16:2197809-2197831 TCTTCCAGCACTCCTGGGAGGGG + Intergenic
1133396967 16:5455497-5455519 TCTCCAAGGCCTCCTTGGGGTGG - Intergenic
1133439082 16:5805646-5805668 TCCCCCTGGAACCCTAGGGGTGG - Intergenic
1134570183 16:15284177-15284199 TACCCCAGGACCCCTGGGGAGGG - Intergenic
1134732192 16:16471876-16471898 TACCCCAGGACCCCTGGGGAGGG + Intergenic
1134935245 16:18240087-18240109 TACCCCAGGACCCCTGGGGAGGG - Intergenic
1136394239 16:29984204-29984226 CCTCCCAGCCCCCCTGGGAGGGG + Intronic
1136491725 16:30612853-30612875 GCTCGCAGGACCCTTGGGGGTGG - Intronic
1137590403 16:49689939-49689961 TCTCCCAGGTCCACTGAGGATGG + Intronic
1138399097 16:56730832-56730854 TCACCAAGGACCCATGGGGTCGG - Intronic
1138532787 16:57643864-57643886 TATCCCAGGACCCATGGGTGCGG + Intronic
1139532267 16:67548192-67548214 CCTCCAGGGACCCCTGGGGCAGG - Intergenic
1139546858 16:67653548-67653570 TCTCTCAGCAGCCCCGGGGGAGG - Intronic
1139590001 16:67928258-67928280 GGTCCCAGGACCTCTGGTGGAGG + Exonic
1141204566 16:81923573-81923595 TCTCCAAGGAGCCCGGGGGCTGG + Exonic
1141466103 16:84206737-84206759 TCTCCCAGGGACCCTGGAGCTGG + Intergenic
1141643016 16:85352462-85352484 TCTCCAGGGCCCCCTGGGAGTGG + Intergenic
1142129373 16:88425776-88425798 TGTCCCATGACCCCGGGAGGAGG - Intergenic
1142673111 17:1496593-1496615 GCTCCCAGGAGCCCTCGGGAAGG + Intronic
1142711290 17:1725188-1725210 TCTCCCAGGCCCTCTGCGCGGGG - Exonic
1142809032 17:2386768-2386790 TCCCCTAGGAGGCCTGGGGGTGG + Exonic
1144669982 17:17127407-17127429 TCACCCAGGTCCCCTGAGAGTGG + Intronic
1144948814 17:18983159-18983181 TCTCCCAGTAGCCCTGGGCTGGG + Intronic
1145105486 17:20111794-20111816 TCACTCAGGACCCAGGGGGGGGG + Intronic
1145272443 17:21411987-21412009 GCTCCCAGCACCCCTGGGGAGGG + Intronic
1145288211 17:21522229-21522251 GCACCCAGGGCCCCTGGTGGGGG + Intergenic
1145310651 17:21699452-21699474 GCTCCCAGCACCCCTGGGGAGGG + Intronic
1145867087 17:28248303-28248325 TCTCTGTGGACCCCTGGTGGGGG + Intergenic
1146053000 17:29567439-29567461 GCTCCCGGGACCCCGTGGGGCGG + Intronic
1146703305 17:34980781-34980803 CCTCCCGGGAGCCCAGGGGGAGG + Intronic
1146908248 17:36631699-36631721 TGTCCCTGGAGCCCTGGGGCTGG + Intergenic
1147161088 17:38569773-38569795 TCCCCTAGCACCACTGGGGGTGG - Intronic
1147442166 17:40453924-40453946 TCTGGCAGGAGCCCTGGGGCTGG - Exonic
1147458688 17:40554690-40554712 TCTCCCAGGGTCCCTGGGGTGGG - Exonic
1147904465 17:43813824-43813846 TCTCAGAGGACCACTGGGAGTGG + Intronic
1147925001 17:43940767-43940789 TCTCTGTGGACCCCTGGTGGGGG - Intergenic
1148357084 17:46982673-46982695 TCTCCCATCATCCCTGGGGGAGG + Intronic
1148460699 17:47837655-47837677 TATCCCAGGACCAGTGGGGGTGG - Exonic
1148899444 17:50865664-50865686 GCTCCCAGGAGCCCGGGGCGGGG - Intronic
1150764558 17:67993281-67993303 TCTCCCAGTCCCCCAGGAGGTGG + Intronic
1151359731 17:73581694-73581716 TCTCAAAGGACACCTCGGGGAGG + Intronic
1151714330 17:75823736-75823758 ACCCCCAGCACCCCTGAGGGCGG + Intronic
1152518301 17:80838872-80838894 CCTTCCAGCACCCCTGGGGTTGG - Intronic
1152659169 17:81534538-81534560 TCTCCCAGGACCCCTGGGGGAGG - Intronic
1152690702 17:81716524-81716546 TCCCCCAGGACCCCGGGGGCTGG + Intronic
1152751204 17:82063202-82063224 TCTCCCAGGACATCTGGGGCTGG + Intronic
1152920590 17:83064598-83064620 TCTCTCTGGACGCCTGGGCGAGG - Intergenic
1154170094 18:12045271-12045293 TCTCCCAGGATCACTTGTGGGGG - Intergenic
1154390360 18:13931537-13931559 GCCCCCAGGACCCCTGCTGGTGG - Intergenic
1156152427 18:34258352-34258374 TATCGCAGGCTCCCTGGGGGAGG - Intergenic
1158901982 18:61972561-61972583 TCTCCCAGCACCCCAGGAGAAGG + Intergenic
1159809066 18:72994643-72994665 TCTCCAAGAAGCCCTGGGAGAGG - Intergenic
1160497106 18:79382179-79382201 TCTTCCTGGGCCCATGGGGGAGG - Intergenic
1160710094 19:547454-547476 ATTCCCCGGACCCCTGGGGTGGG - Intronic
1160715856 19:576238-576260 TCTCCTAGCACCCCTGGGTGAGG + Intronic
1160805110 19:989249-989271 CCTTCCAGGACACCTGGGGAGGG - Intronic
1160985282 19:1835807-1835829 CCTCTCAGGACCACTGGGGCTGG - Intronic
1161026073 19:2038032-2038054 CTTCCAAAGACCCCTGGGGGGGG - Exonic
1161067631 19:2246472-2246494 TATCCCAGCACCCCTGGTGAAGG + Intronic
1161112364 19:2477427-2477449 TCTCCCGGGGCCCCTGTGTGGGG - Intronic
1161139423 19:2638726-2638748 TCTCCCAGCATCCCCTGGGGAGG + Intronic
1161205137 19:3036853-3036875 TCTCTCAGAACCCCTGTGGTCGG + Intronic
1161318864 19:3631944-3631966 TTCCCCAGGACCCCTGAGAGGGG - Exonic
1161689154 19:5720814-5720836 GCTGCCAGGACTCCTGGGGCTGG + Intronic
1161766827 19:6212998-6213020 CCTCCCAGGACCCCGGCGGTGGG + Exonic
1161770556 19:6228647-6228669 TCTCCCAGCACCCACGGCGGGGG + Intronic
1162395812 19:10417650-10417672 TCTCCCTCGACCTCTGGGGAGGG - Intronic
1162511371 19:11120751-11120773 TCTGACAGGAGCCCTGAGGGAGG + Intronic
1162744936 19:12792868-12792890 GCTCCCTGGACCCCAGTGGGAGG - Exonic
1163034642 19:14563726-14563748 CCACCCAGGAGCCCAGGGGGCGG - Intronic
1163160985 19:15464083-15464105 TCTCCAAGGCCCTCTGGGGGAGG - Exonic
1163404616 19:17114340-17114362 TCTCCCTCGTCCCTTGGGGGAGG + Intronic
1163761377 19:19138358-19138380 TCTCCCTGGACCCCTTCGGCTGG + Intronic
1163804366 19:19386753-19386775 TCTCTGAGGACCCCTGCCGGAGG + Intronic
1163846922 19:19643283-19643305 TCACCCCAGACGCCTGGGGGAGG - Intronic
1164750259 19:30648456-30648478 TATCTCAGGACCCCTGGGCAGGG + Intronic
1164892525 19:31836986-31837008 TCTCCCAGCACACCTGGCAGGGG - Intergenic
1165941052 19:39415013-39415035 GCTCCCAGAACCTCGGGGGGAGG - Exonic
1165982754 19:39738411-39738433 TCTCCCAGAACCACTGGAGAAGG - Intergenic
1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG + Intronic
1166678708 19:44754669-44754691 TCTCCCAGGACGCCTGGCCTGGG - Intronic
1167074237 19:47239485-47239507 TCTCCCGGGTCCCCTCGGTGTGG + Intergenic
1168651942 19:58097494-58097516 TCTCCCCAGTCACCTGGGGGTGG - Intronic
926219700 2:10926395-10926417 TCTCCCAGGCTCCCTGGGTAGGG + Intergenic
927826982 2:26315978-26316000 TAGCCCAGGATACCTGGGGGAGG - Intronic
928080763 2:28310339-28310361 TCTCCTGGCTCCCCTGGGGGAGG + Intronic
934561171 2:95314136-95314158 TTTCCCAGGAGCACTGGTGGTGG - Intronic
934853136 2:97713721-97713743 TCTCCCAGAGCCCCCTGGGGTGG - Intronic
935718556 2:105959997-105960019 TGTCTCAGGAGCCCAGGGGGAGG - Intergenic
936172172 2:110185880-110185902 TCTCCCAAGGCCCCTGGAAGGGG - Intronic
937572412 2:123380556-123380578 TCTCACAGGAGGCCTTGGGGAGG + Intergenic
937883017 2:126882564-126882586 TCTCTCAGGGCTCCTGGTGGGGG - Intergenic
938587216 2:132702797-132702819 TCTCCCAGGAACCTCGGGGTAGG + Intronic
940078167 2:149767619-149767641 TTTCCCAGGACACGTGGGAGTGG + Intergenic
940830071 2:158457042-158457064 TCTCCCACCACCCCCGGCGGCGG - Intronic
941934680 2:170973661-170973683 CCTCGCAGGGCCCCTGGGCGGGG + Intergenic
943909253 2:193542275-193542297 CCTCACAGGAGCCCTTGGGGAGG + Intergenic
945783287 2:214203706-214203728 TCTCCCAGGGGTCCTTGGGGAGG + Intronic
946032205 2:216714240-216714262 TCTCCCAGGACTGCTGTGGAGGG + Intergenic
946102621 2:217339499-217339521 TTTACCATGTCCCCTGGGGGTGG - Intronic
947593938 2:231399425-231399447 TCTCCCAGGAGACCAGGGTGTGG - Exonic
947874683 2:233460378-233460400 AGTCCCAGGGACCCTGGGGGAGG - Intronic
948036747 2:234863857-234863879 ACTTCCAGGACTTCTGGGGGTGG + Intergenic
948107602 2:235427910-235427932 TCACCCAGGAGCCCTGGGCTGGG - Intergenic
948474752 2:238210174-238210196 TGTCCCTAAACCCCTGGGGGAGG + Intergenic
948703259 2:239774026-239774048 TCTTCCAGGACCCCCGGGACAGG + Intronic
948771186 2:240251946-240251968 CAGCCCAGCACCCCTGGGGGAGG - Intergenic
948867685 2:240783868-240783890 CATCCCAGGACCCCTGGGCAAGG + Intronic
948892414 2:240913974-240913996 CCTCCCAGCATCCCTGGGCGGGG - Intergenic
948912389 2:241011079-241011101 TCTCCTGGGTCTCCTGGGGGTGG + Intronic
948912399 2:241011106-241011128 TCTCCTGGGTCTCCTGGGGGTGG + Intronic
948912411 2:241011142-241011164 TCTCCTGGGTCTCCTGGGGGTGG + Intronic
948912424 2:241011178-241011200 TCTCCTGGGTCTCCTGGGGGTGG + Intronic
948912446 2:241011241-241011263 TCTCCTGGGTCTCCTGGGGGTGG + Intronic
1170612882 20:17928872-17928894 TCGCCAAGGGCCCCTGGGGAGGG - Intergenic
1171223563 20:23421662-23421684 TGGCCCAGGACCCCTTTGGGGGG - Intergenic
1173465655 20:43279077-43279099 TGTCCCAGGCCCCCAGGGGCAGG + Intergenic
1173881018 20:46412336-46412358 TCTCCTGGGACCCTGGGGGGTGG - Intronic
1173907065 20:46637158-46637180 CCTCCCAGGATGCCTGGGGCAGG - Intronic
1174516861 20:51099188-51099210 TCTCCCTGGGCCTCTGGAGGTGG + Intergenic
1175401262 20:58701227-58701249 TCTCCCGGGTGCCCTGGGGGTGG + Intronic
1175401324 20:58701358-58701380 TCTCCAGGGTGCCCTGGGGGGGG + Intronic
1175459523 20:59141919-59141941 TCTCCCAGCACCCCTGTGTTGGG + Intergenic
1175810391 20:61854507-61854529 TCACACTGCACCCCTGGGGGTGG - Intronic
1175810496 20:61854920-61854942 TCACACTGCACCCCTGGGGGTGG - Intronic
1175810509 20:61854966-61854988 TCACACTGCACCCCTGGGGGTGG - Intronic
1175810548 20:61855104-61855126 TCACACTGCACCCCTGGGGGTGG - Intronic
1175934306 20:62508057-62508079 TCCGCCAGGGCCCCTGGGGCAGG - Intergenic
1177433746 21:21024369-21024391 TCTCCAAGAAATCCTGGGGGGGG + Intronic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1179275862 21:39891245-39891267 TCTCTGAGGACCCCCGTGGGTGG + Intronic
1179826084 21:43967238-43967260 GCTCCAAGAACCCCTGGGTGGGG + Intronic
1179987170 21:44928268-44928290 TCTTCCAGGCCCCCTGGGGGTGG + Intronic
1180022289 21:45136049-45136071 TGTCCCTGGGCCCATGGGGGTGG + Intronic
1180045113 21:45301651-45301673 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1181022801 22:20112506-20112528 GCTCCCAGGGCCCCAGGGGCGGG - Exonic
1181305806 22:21916599-21916621 TCTCTCAGGACCTCTGGGTGGGG - Intergenic
1181591616 22:23889086-23889108 CCTCCCAGGAGCCCTGTGTGTGG + Intronic
1181749108 22:24976639-24976661 GCACCCAGCACCCCTGTGGGTGG + Intronic
1182902629 22:33911045-33911067 TCTCACAGCAACCCTGGGAGGGG - Intronic
1183586801 22:38757495-38757517 TCTGCCAGGACCCCCGGAGAGGG - Intronic
1184047035 22:41977966-41977988 TCTCCTAGGGCCCCTGGAGAAGG - Intronic
1184198399 22:42947655-42947677 CTTCACAAGACCCCTGGGGGTGG + Intronic
1184424879 22:44403480-44403502 CCCCCCAGGACCCCAGGGGATGG + Intergenic
1184754422 22:46508144-46508166 TGTCCTAGGAGCCGTGGGGGAGG - Intronic
1185275508 22:49948840-49948862 CTGCCCAGGTCCCCTGGGGGAGG + Intergenic
1185418941 22:50724558-50724580 TCTCCCAGGAGCCAGGGGGATGG + Intergenic
949863460 3:8527572-8527594 TCTCCCAGAACCCCTAGGGAAGG + Intronic
951691097 3:25397151-25397173 TCTCACAGGGACCCTTGGGGAGG - Intronic
953611412 3:44450517-44450539 TCTCCCAGGACGAGTGGGGGTGG - Exonic
954301307 3:49702152-49702174 ACTCCCAGGAGCCCTGGGTGGGG + Intronic
954433299 3:50482774-50482796 TGTCCAAGGAGCCCTGGGGAAGG + Intronic
955350490 3:58189806-58189828 TCTCCCAGTCCCCCTTGGTGAGG - Intergenic
957073309 3:75581883-75581905 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
959815176 3:110666250-110666272 TCTCACAGGGGCCCTTGGGGAGG + Intergenic
960703507 3:120459846-120459868 TTTCAGAGGACCCCTGGGGATGG + Intergenic
961214084 3:125146520-125146542 TCTCTGAGGATCCCTGGGGAGGG - Intronic
961508634 3:127387969-127387991 ACTCCCAGGTCCCCAGGGGCAGG - Intergenic
961584390 3:127910222-127910244 CCTCCCAGGAGACCTGGAGGTGG + Intergenic
961796716 3:129414384-129414406 TCACACAGGAGCCCTGGAGGAGG - Intronic
961873620 3:130004689-130004711 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
962267681 3:133955269-133955291 TCTCCCAGGCCCCTTGGGGAAGG + Intronic
962756813 3:138471032-138471054 TCTCTCCGGTCCCCTGGGGGAGG + Intronic
962808460 3:138943167-138943189 TCTCGCAGGATGCCTGTGGGGGG + Intergenic
962837156 3:139199549-139199571 TGCCCCAAGTCCCCTGGGGGAGG - Intronic
968757764 4:2425792-2425814 TCTCCAAGGTCCCCTGGGAGGGG + Intronic
968898321 4:3418176-3418198 GCTCCCAGGGCGCCAGGGGGTGG + Intronic
968966382 4:3771012-3771034 TCTCCCAGGATCCCTGGGTGTGG - Intergenic
969532273 4:7736624-7736646 TCCCCCAGGACGCCTGGATGGGG + Intronic
972438254 4:39056352-39056374 AATCCCAGCACCCCTGAGGGTGG - Intronic
972855696 4:43104017-43104039 TGTACCAGGACCCTTGTGGGAGG + Intergenic
973606619 4:52593515-52593537 TCACCCAGGGCACCTGTGGGTGG - Exonic
973885364 4:55315522-55315544 TATCCCAGCACCCCTGGGTGTGG - Intergenic
975718424 4:77227712-77227734 TCCCCAAGGACCCCTGTGAGAGG + Intronic
976462860 4:85333249-85333271 TCTCACAGGAGTCCTTGGGGAGG + Intergenic
977682409 4:99810924-99810946 TAACCCAGGACCCCTAGGGATGG + Intergenic
977682442 4:99811027-99811049 TGACCCAGGACCCCTAGGGATGG + Intergenic
978189598 4:105896122-105896144 GCTTCCAGGCCCCCGGGGGGAGG + Intronic
979356914 4:119715488-119715510 TCTCACAGGAGTCCTTGGGGAGG + Intergenic
981527382 4:145720222-145720244 TCTCCCAGGAAAGCTGGGGGAGG - Intronic
982800380 4:159698217-159698239 TCTCACAGGAGTCCTTGGGGAGG - Intergenic
984661608 4:182381055-182381077 TCTCTCCGTACCCCTGAGGGAGG + Intronic
984918426 4:184743512-184743534 TCTACCAGGATGCCTGGGGCGGG + Intergenic
985493308 5:191589-191611 TCTGCCGGGCCACCTGGGGGTGG - Exonic
985537581 5:473603-473625 TGTCCCGGGACCCCCGGCGGGGG - Intronic
985573851 5:664707-664729 CCTTCCAGGAGCCCTGAGGGTGG - Exonic
985946177 5:3185765-3185787 TCCCCCAGCACCCTTGTGGGGGG - Intergenic
990545446 5:56816382-56816404 TCTCCGAGGAGCCCGGGGGCGGG + Intronic
990558865 5:56963931-56963953 TTGCCCAGGTCCCCTGTGGGTGG - Intronic
995080621 5:108047413-108047435 CCTGCCAGGTCCCCAGGGGGAGG + Intronic
998153294 5:139769453-139769475 TCTCCCAGCTCCTCTGTGGGGGG + Intergenic
1001870808 5:175154033-175154055 TCTACTAGGACCCCTGGAAGGGG + Intergenic
1001929275 5:175661231-175661253 TCTTTAAGGAGCCCTGGGGGAGG - Intronic
1002449057 5:179308805-179308827 CATCCCAGGGCCCCTGGGGTGGG - Intronic
1002501344 5:179649540-179649562 TATCCAAACACCCCTGGGGGCGG + Intergenic
1002699045 5:181109757-181109779 CCTCCCAGCAGCCCTGGGGTGGG - Intergenic
1003270457 6:4603292-4603314 TCCTCCAGGAGCCCTGGGAGGGG + Intergenic
1003368363 6:5499228-5499250 TCTCCCAGGTTCCTTGGGGTAGG - Intronic
1003584231 6:7372173-7372195 TCTCAAAGGAACCCTGGGGTTGG + Intronic
1005009538 6:21322760-21322782 TCTCCCTGGACCCTTGGTAGAGG - Intergenic
1005354454 6:24969148-24969170 CCTCCCAGGACTACTGGGTGGGG - Intronic
1006116360 6:31778003-31778025 TCTCCCAAGAGCCCTGGGAGGGG - Intronic
1006322628 6:33329182-33329204 TCGCACGGGACCCCTGGGAGGGG + Intronic
1008817218 6:55582456-55582478 TGTCCCATAACCTCTGGGGGTGG + Intergenic
1009644267 6:66377652-66377674 TCTCACAGGAGTCCTTGGGGAGG + Intergenic
1012786948 6:103642509-103642531 GCTCCCAGGACAGCTGGGGTTGG + Intergenic
1013360968 6:109393653-109393675 TCTCCCACGGCCTCTCGGGGAGG + Intronic
1013656864 6:112255006-112255028 TCTCCCAAGCCCTCTGGGTGAGG - Intergenic
1014313257 6:119831157-119831179 TCTCACAGGAGTCCTTGGGGAGG - Intergenic
1015440550 6:133241773-133241795 TCCCCCGGGAGCCCTGGGGCGGG - Intronic
1016854291 6:148651111-148651133 TCACTCAGCACTCCTGGGGGTGG - Intergenic
1018200307 6:161388248-161388270 TCTCATATGACCCCTGGGAGAGG + Intronic
1018628884 6:165805346-165805368 TCTCCCAGGGCCCCGGAGGGAGG + Intronic
1018641631 6:165909225-165909247 ACTCCCAGGGCCCCTGGCTGGGG + Intronic
1018962453 6:168458268-168458290 CCTCCCAGGACCCCCAGGGCAGG - Intronic
1018962475 6:168458330-168458352 CCTCCCAGGACCCCCAGGGCAGG - Intronic
1019062609 6:169266867-169266889 TGTCCCAGGGCCCCCAGGGGTGG + Intergenic
1019424481 7:967709-967731 CCTCCGAGCACCCCTGGGGGTGG - Exonic
1019846984 7:3513198-3513220 TCTCCCAGCACCACTGTGGGTGG + Intronic
1020040305 7:4996507-4996529 CCTCCCAGCAACCCTGGGGTAGG - Intronic
1020100017 7:5389258-5389280 TCGGCCCGGACCCCTGGCGGCGG - Exonic
1020141872 7:5616140-5616162 GTTCTCAGGACCCCTGCGGGGGG - Intergenic
1020455760 7:8372229-8372251 TCTCTCAGGGGTCCTGGGGGAGG - Intergenic
1022871932 7:34488984-34489006 TCTCTCAGGACCCCTGCCGCTGG - Intergenic
1023286930 7:38630726-38630748 TCTCCCAGGACCAATAGGGTAGG - Intronic
1023628311 7:42138556-42138578 TTTCCCTTCACCCCTGGGGGAGG + Intronic
1023750436 7:43366879-43366901 TCTCCCGGGATCTCAGGGGGTGG - Intronic
1023819085 7:43970449-43970471 CCTCCCAGCAGCCCTAGGGGAGG - Intergenic
1023819134 7:43970713-43970735 CCTCCCAGCAGCCCTAGGGGAGG - Intergenic
1023820283 7:43977013-43977035 GCTCCCAGGACCCATAGGTGAGG - Intergenic
1024000206 7:45184739-45184761 GATCCCAGGACCCCTGTGAGTGG + Intronic
1027333194 7:77121687-77121709 CCTCCACGGACGCCTGGGGGTGG + Intergenic
1027420644 7:78014743-78014765 TGTCCCACCACCCCTGGGGAGGG - Intergenic
1028860817 7:95648388-95648410 TCTCCCAGGAACCCAGGAGGCGG - Intergenic
1029548247 7:101222607-101222629 GCTCCCAGGACCCCGGGCAGCGG + Exonic
1029582736 7:101448105-101448127 GCACCCAGAACCCCTGGGGCAGG + Intronic
1029744138 7:102507408-102507430 CCTCCCAGCAGCCCTAGGGGAGG - Intronic
1029744185 7:102507676-102507698 CCTCCCAGCAGCCCTAGGGGAGG - Intronic
1029748568 7:102530534-102530556 GCTCCCAGGACCCATAGGTGAGG - Intergenic
1029762129 7:102606571-102606593 CCTCCCAGCAGCCCTAGGGGAGG - Intronic
1029762176 7:102606838-102606860 CCTCCCAGCAGCCCTAGGGGAGG - Intronic
1029766515 7:102629618-102629640 GCTCCCAGGACCCATAGGTGAGG - Intronic
1029782598 7:102749615-102749637 CCTCCACGGACGCCTGGGGGTGG - Exonic
1029852657 7:103480988-103481010 TCTCCCAGGTCACCTGGTGTTGG - Intronic
1030654752 7:112154679-112154701 TCTCCCAGGAACACTGGCGTGGG + Intronic
1032083332 7:128870650-128870672 ACTCCCGGGACCCCTGGGCCGGG - Intronic
1032121041 7:129156814-129156836 TCTCCAAGGAGCCCAGGGGATGG + Intronic
1032873803 7:136015418-136015440 TCTCCCAGGACCCTTGGGAAAGG + Intergenic
1034164614 7:149015841-149015863 TGCCTCAGGACCCCTGGGTGTGG - Intronic
1034258361 7:149736927-149736949 TCCATCAGGACCCCTGGGGGTGG - Intergenic
1034529984 7:151689627-151689649 TCTCCCAGGAGGCCAGGTGGCGG + Intronic
1034555024 7:151845039-151845061 TCTCCCAGCACCCTTGTGCGGGG - Intronic
1034976644 7:155453181-155453203 TCTCCCGGGAGCCCTGGGAGGGG - Intergenic
1035171972 7:157021890-157021912 GCTCCCAAGACCCCGGCGGGAGG - Intergenic
1035328886 7:158083827-158083849 GCTCTCAGGAACCCTGTGGGAGG + Intronic
1035330898 7:158096865-158096887 ACTCCCAGGAGCCCCAGGGGAGG - Intronic
1035534461 8:380398-380420 TCCCCCAGGACCCAGGTGGGGGG - Intergenic
1036242134 8:7090346-7090368 CCTCACAGCAGCCCTGGGGGTGG - Intergenic
1036258647 8:7223612-7223634 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036259703 8:7229754-7229776 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036306909 8:7609768-7609790 CCTCACAGCAGCCCTGGGGGTGG - Intergenic
1036307972 8:7615897-7615919 CCTCACAGCAGCCCTGGGGGAGG - Intergenic
1036310702 8:7682208-7682230 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036311746 8:7688324-7688346 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036357760 8:8057756-8057778 CCTCACAGCAGCCCTGGGGGTGG - Intergenic
1036358827 8:8063898-8063920 CCTCACAGCAGCCCTGGGGGTGG - Intergenic
1036444641 8:8810929-8810951 TCTCCCAGGACTCTTCAGGGAGG - Intronic
1036753995 8:11460462-11460484 ACTCCCTGGCCCCGTGGGGGTGG - Intronic
1036892130 8:12603054-12603076 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036893190 8:12609190-12609212 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036899676 8:12661030-12661052 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1036900744 8:12667177-12667199 CCTCACAGCAGCCCTGGGGGTGG + Intergenic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1039006998 8:33050574-33050596 ACTCCCAGGACCCTTGGGAGTGG + Intergenic
1040447208 8:47507521-47507543 TTTCCCATGAGCCCTGGTGGGGG + Intronic
1041381080 8:57254964-57254986 GTTCCCTGGATCCCTGGGGGTGG - Intergenic
1042504824 8:69548970-69548992 TCTCCTGGGAGCCCTGGGTGGGG - Intronic
1043354362 8:79395168-79395190 TTTCCCAGCTCCCCTGGGGCTGG + Intergenic
1045270147 8:100654612-100654634 ATTCCCAGGTCCCCTGGGGTGGG - Intronic
1045555680 8:103212909-103212931 TCTTCCAGCATGCCTGGGGGAGG - Exonic
1046080292 8:109362710-109362732 TCTCCCAGGACCCCGGGAGCAGG - Intronic
1047904782 8:129460955-129460977 TCTGCCAGGACACCAGGGAGGGG + Intergenic
1048230632 8:132637236-132637258 TGACCCAGAAACCCTGGGGGAGG + Intronic
1049195884 8:141315414-141315436 CCACCCAGGACCCCTGCGGCAGG + Intergenic
1049236952 8:141517187-141517209 TCTCCCAACACCCTTGGGAGGGG - Intronic
1049341606 8:142115393-142115415 TCTCCCAGGAGGCCTGGACGAGG + Intergenic
1049382476 8:142324339-142324361 TCTCCCAGCACTCCTGTGCGAGG + Intronic
1049418537 8:142506429-142506451 TCACCCTGGACACATGGGGGTGG + Intronic
1049531833 8:143159051-143159073 GCCCCCATGACCCCTGGAGGGGG + Intronic
1049710506 8:144060936-144060958 TTGCCCAGGACACCTGGAGGTGG - Intronic
1050648281 9:7746024-7746046 ACCCCCAGGACCCATTGGGGTGG - Intergenic
1051170794 9:14316079-14316101 TCCTCCAGGTCCGCTGGGGGAGG - Intronic
1051173823 9:14345033-14345055 ACTCCCAGAACCCCTGGAGCTGG - Intronic
1057860820 9:98639462-98639484 TCCCCCACCACCCCTGGGAGAGG + Intronic
1059423939 9:114209304-114209326 CCTACCAGCATCCCTGGGGGTGG + Intronic
1059747246 9:117214825-117214847 TCTGCCAGGATCCCTGGGTTTGG + Intronic
1061217091 9:129227706-129227728 CCTCCCAGCACCCCCGGTGGAGG + Intergenic
1061362367 9:130151744-130151766 TCACCCAGGAGCCCTGGCTGGGG + Intergenic
1061732734 9:132629007-132629029 TGTACCAGGAACCCTGGGGAAGG - Intronic
1061903642 9:133685494-133685516 GCTAGCAGGACCCCTGGGGGAGG + Intronic
1062035147 9:134379648-134379670 CCTCCCAGGACCGCAGGGTGGGG - Intronic
1062165033 9:135103398-135103420 GCTCCCAGGGCCCTTGGGGCTGG - Intronic
1062296080 9:135827947-135827969 TCTCCCAGGAGCCTGGGTGGTGG - Intronic
1062317930 9:135977652-135977674 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062317945 9:135977688-135977710 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062317960 9:135977724-135977746 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062317973 9:135977760-135977782 TGTCCCAGGGCTGCTGGGGGCGG - Intergenic
1062317988 9:135977796-135977818 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062318003 9:135977832-135977854 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062318017 9:135977868-135977890 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062318031 9:135977904-135977926 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062318044 9:135977940-135977962 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062318057 9:135977976-135977998 TGTCCCAGGGCTGCTGGGGGTGG - Intergenic
1062387282 9:136317849-136317871 TCTCCCAGGACCGCTGGAGGAGG + Intergenic
1062523182 9:136968121-136968143 ACTGCCAGGACCCTTGGTGGGGG - Intergenic
1062555689 9:137112579-137112601 CTTCCCAGAAACCCTGGGGGAGG - Intronic
1185620617 X:1450958-1450980 TAACCCAGGACCCCTAGGGATGG - Intronic
1186486048 X:9935217-9935239 TCTCCCGGGAGCCGGGGGGGCGG + Intronic
1190540227 X:51469710-51469732 TCACCAAGGACCCCAGGAGGAGG + Intergenic
1191045272 X:56129558-56129580 TCTCACAGGAGTCCTGTGGGAGG + Intergenic
1192211600 X:69131338-69131360 TCTCCACAGAGCCCTGGGGGAGG - Intergenic
1192573568 X:72225263-72225285 TGTCCCTAAACCCCTGGGGGAGG - Intronic
1193954700 X:87845019-87845041 TCTCACAGGGCCCTTGGGGAAGG - Intergenic
1194301662 X:92194711-92194733 TCTCCCAGGTGCCCTAGGGCAGG + Intronic
1195924810 X:110014860-110014882 TCACCCAGGAGCTCTGGGGGTGG - Intronic
1196388915 X:115189763-115189785 TCACACAGAACCCGTGGGGGTGG + Exonic
1198498094 X:137214149-137214171 TCACTCAGCACTCCTGGGGGTGG - Intergenic
1199894026 X:152115384-152115406 GGTCCCAGGCACCCTGGGGGAGG - Intergenic
1200056284 X:153463089-153463111 CCTGCCAGCAGCCCTGGGGGTGG + Intronic
1200144808 X:153921051-153921073 TCTCCCTGGACCATTGGGGCAGG + Intronic
1200216811 X:154371700-154371722 TTCCCCAGGGCCCCTGCGGGGGG + Intronic
1201766124 Y:17574995-17575017 TCAACCAGGGCCCCTGGGGGGGG + Intergenic
1201835428 Y:18330994-18331016 TCAACCAGGGCCCCTGGGGGGGG - Intergenic
1201992548 Y:20043308-20043330 TTTCCCGGGCCCCATGGGGGTGG + Intergenic