ID: 1152659292

View in Genome Browser
Species Human (GRCh38)
Location 17:81535006-81535028
Sequence CCCTCACGCCTCTCCTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152659292_1152659307 24 Left 1152659292 17:81535006-81535028 CCTACCCAGGAGAGGCGTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 200
Right 1152659307 17:81535053-81535075 GGTCAACGTCTCAGCCAATCAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1152659292_1152659299 3 Left 1152659292 17:81535006-81535028 CCTACCCAGGAGAGGCGTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 200
Right 1152659299 17:81535032-81535054 TCCCCATCTCCTCCCTCCAGGGG 0: 1
1: 0
2: 8
3: 65
4: 507
1152659292_1152659297 1 Left 1152659292 17:81535006-81535028 CCTACCCAGGAGAGGCGTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 200
Right 1152659297 17:81535030-81535052 CTTCCCCATCTCCTCCCTCCAGG 0: 1
1: 1
2: 6
3: 89
4: 811
1152659292_1152659298 2 Left 1152659292 17:81535006-81535028 CCTACCCAGGAGAGGCGTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 200
Right 1152659298 17:81535031-81535053 TTCCCCATCTCCTCCCTCCAGGG 0: 1
1: 0
2: 3
3: 77
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152659292 Original CRISPR CCCTCACGCCTCTCCTGGGT AGG (reversed) Intronic
900190013 1:1349293-1349315 CCCTCGCGCCGCTCCCGGGCCGG - Intronic
900854464 1:5169920-5169942 GCCTCACGCCCCTGCTGGCTCGG - Intergenic
900951877 1:5862650-5862672 CGCTCAAGCCTGCCCTGGGTGGG - Intergenic
901555620 1:10029153-10029175 CCCTCACCTCCCTCCCGGGTGGG - Intergenic
902414107 1:16228955-16228977 CCCTTCCGCCTCTGGTGGGTGGG - Intergenic
903272910 1:22202835-22202857 CCCTCAGCCCCCTCCTTGGTTGG + Intergenic
903738109 1:25543359-25543381 CCCTCAGGCCCCTACGGGGTGGG + Intergenic
904744120 1:32700839-32700861 ACCTCACGCCTATCCTAGGAGGG - Intronic
905258891 1:36703832-36703854 TCCTCCCGCCCCTCATGGGTTGG - Intergenic
905707767 1:40074965-40074987 CCACCGCGCCTGTCCTGGGTTGG - Intronic
905925871 1:41749287-41749309 CCCTCTCACTTCCCCTGGGTGGG + Intronic
906139578 1:43525966-43525988 CCCACACGCCTCTCCAGAGTGGG - Intronic
907141611 1:52191052-52191074 CCCTAACGCCTCCAGTGGGTGGG + Intronic
907251430 1:53142265-53142287 CCCACACGCCCCTCCTGGACAGG + Intronic
911462776 1:98211710-98211732 CACCCAGGCATCTCCTGGGTGGG - Intergenic
912452492 1:109775904-109775926 CCCTCACCCCTCAGCTGGTTTGG + Intergenic
912585848 1:110764641-110764663 CCTTCACCTCTCTCCTGTGTTGG - Intergenic
912953377 1:114135800-114135822 CCCTCACCCCTCTCCCTGGGTGG + Intronic
915601207 1:156924265-156924287 CACTCGCGCCTCTGCTGGGTTGG - Intronic
916932914 1:169597989-169598011 CCCTCACTCTTCTACTGGATGGG + Intronic
917957910 1:180119143-180119165 CCCTCACGCTTTTCCCGGGTTGG - Intergenic
919807176 1:201387017-201387039 GCCTCCAGCCTCTCCTGGATGGG + Exonic
921283896 1:213591842-213591864 CCTTCACACCTTTCCTGAGTTGG + Intergenic
1064016833 10:11779424-11779446 CCCTTGCCCCTCTCCTGGGTTGG - Intergenic
1067338028 10:45379902-45379924 CCCTCTCCCCACTCCTCGGTGGG + Intronic
1069157799 10:65052279-65052301 CCCCCACCTCTCTCCTGGATGGG - Intergenic
1070501366 10:77075725-77075747 CCCTCACTCCTTCCCTGCGTTGG - Intronic
1074298241 10:112210621-112210643 CTCTCCCACCTTTCCTGGGTGGG - Intronic
1076818305 10:132925389-132925411 CCCTCACGCTGCCCCTGGGCTGG + Intronic
1077077127 11:706874-706896 CCCTCCTGCCTCTCCTGGCAGGG - Intronic
1078250688 11:9614189-9614211 CCCACGCGCCGCTCCTGGGCAGG + Intergenic
1079030439 11:16982389-16982411 CCTGCACCCCTTTCCTGGGTTGG - Intronic
1080751814 11:35157773-35157795 CCCTCACACTTATCCTGAGTGGG - Intronic
1082839817 11:57679811-57679833 CACACATGCCTCTCCTTGGTGGG + Intronic
1083934722 11:65864253-65864275 CCTTCAAGCCTCCCCTGGGCCGG - Intronic
1083995157 11:66267999-66268021 CCCTCACGCAATTCCGGGGTGGG - Intergenic
1084179175 11:67438094-67438116 CCCTCCCGCCTCCTCTGGGGAGG + Exonic
1084189394 11:67492109-67492131 CCCTCACGCTCCGCCTGGCTGGG + Exonic
1084762569 11:71283294-71283316 CCCTGAGGACTCTCCAGGGTTGG - Intergenic
1085810654 11:79678008-79678030 CCCTGAGGCTTCTCCTGGCTTGG - Intergenic
1086049786 11:82576965-82576987 CCTCCAGGCCACTCCTGGGTGGG - Intergenic
1089177241 11:116557739-116557761 CCCAGACTCCTCTCCTGGGAAGG + Intergenic
1089657424 11:119960837-119960859 CCCTTACCGCTTTCCTGGGTGGG - Intergenic
1090106011 11:123854339-123854361 GCCCCAAGCTTCTCCTGGGTGGG - Intergenic
1094415772 12:30213323-30213345 CCCTGAGGCCTCTCCTGGGAAGG + Intergenic
1094800076 12:34022791-34022813 CTCTCAGGCCTCTCCTGGGGTGG - Intronic
1095112866 12:38317085-38317107 CTTTCAGGCCTCTCCTGGGGTGG - Intronic
1095698960 12:45171324-45171346 CCCTCTCTCCTCTCCTGGTATGG + Intergenic
1096127519 12:49130819-49130841 CCTTCCCGCCGCTCCTGGGCGGG - Intronic
1096614251 12:52822839-52822861 CCATCACTCCTCTCCTTGGTTGG - Intronic
1098531157 12:71543264-71543286 CCCACATGCCTTTCCTGGGCTGG + Intronic
1104633381 12:130423354-130423376 ATCTCGCACCTCTCCTGGGTGGG + Intronic
1104957673 12:132474390-132474412 CCCTCTCACCGCGCCTGGGTGGG + Intergenic
1110286337 13:73753992-73754014 CTCTCTCTCCTCTCCTGAGTGGG - Intronic
1111766462 13:92536460-92536482 CCCTCTCACCTCTCCTGGATTGG + Intronic
1115534618 14:34361454-34361476 CCCCGAGGCCTATCCTGGGTTGG - Intronic
1117279102 14:54220100-54220122 CCCTCACTCCTCTCCCGAATCGG + Intergenic
1117315429 14:54567203-54567225 CCCTCACGGCCCGCCTGGGGTGG - Intronic
1118438685 14:65793441-65793463 CCCTCACTTCTCACCTCGGTTGG - Intergenic
1123035443 14:105469999-105470021 CCCTCCCGCCTGCCCTGGGAAGG - Intronic
1123989680 15:25674142-25674164 CCCTGACGCCCCTGCAGGGTTGG + Intergenic
1129707800 15:77804700-77804722 GCCTCAGGCCACTGCTGGGTGGG - Intronic
1130924441 15:88374743-88374765 CCCTCCTTCCTTTCCTGGGTAGG - Intergenic
1132684741 16:1157599-1157621 CCCGCAGGCCTCTCGTGGGCAGG + Intronic
1132697930 16:1210191-1210213 CCCCCAGGTCCCTCCTGGGTGGG + Intronic
1132872020 16:2119562-2119584 CCCCCAGGCCTCTCCTGGCTTGG - Intronic
1134520505 16:14917334-14917356 CCCCCAGGCCTCTCCCGGCTTGG + Intronic
1134551069 16:15138640-15138662 CCCCCAGGCCTCTCCCGGCTTGG - Intronic
1134708177 16:16315985-16316007 CCCCCAGGCCTCTCCCGGCTTGG + Intergenic
1134715393 16:16356018-16356040 CCCCCAGGCCTCTCCTGGCTTGG + Intergenic
1134951425 16:18352660-18352682 CCCCCAGGCCTCTCCCGGCTTGG - Intergenic
1134959364 16:18396141-18396163 CCCCCAGGCCTCTCCTGGCTTGG - Intergenic
1138405308 16:56788207-56788229 CTCTCTCTCCTCTCCTGGGAGGG - Intronic
1140419617 16:74807624-74807646 GCCTCTCTCCTCTCCTGGGGAGG - Intergenic
1140994180 16:80243536-80243558 CCCCCACGTCACTCCTGGATGGG - Intergenic
1142211625 16:88811313-88811335 CGGTCACGCCTGTCCTGGGCTGG + Intronic
1143525374 17:7468844-7468866 TCCTGACACCTCTCCTGGATGGG + Intronic
1143563903 17:7710068-7710090 GCCTCTCCCATCTCCTGGGTGGG + Exonic
1144711349 17:17403641-17403663 CCCTCACCCTCCTGCTGGGTGGG - Intergenic
1144725995 17:17503066-17503088 CCCTGGACCCTCTCCTGGGTCGG + Intergenic
1145234845 17:21201212-21201234 CCCTAACCCCGCCCCTGGGTGGG + Intronic
1145913776 17:28558403-28558425 CCCTGACGGCTCAGCTGGGTAGG - Intronic
1148052263 17:44775142-44775164 CCCTCACCCCTCTCAAGGCTGGG - Intronic
1148578101 17:48725393-48725415 CCCTGTCTCCTCTCCTGGGAAGG - Exonic
1150263405 17:63815304-63815326 CCCTCAAGGCTCTCCTGGAAGGG - Intronic
1150884562 17:69070507-69070529 CCCTCACGCTTCCCTTGGCTAGG - Intergenic
1151363228 17:73600950-73600972 CCCTGAGGCCTCTCTTGGGTGGG - Intronic
1152034832 17:77865678-77865700 CCCTCTTGCCTCTCCTGCATGGG + Intergenic
1152104258 17:78319466-78319488 ACCTCTGCCCTCTCCTGGGTGGG + Intergenic
1152205204 17:78970956-78970978 CCCTCACCCCTTATCTGGGTAGG - Intergenic
1152659292 17:81535006-81535028 CCCTCACGCCTCTCCTGGGTAGG - Intronic
1156473946 18:37394215-37394237 CCCTCGCGCCTGTCCAGAGTGGG - Intronic
1157590465 18:48833550-48833572 ACCTCACCCCTTTCCTAGGTAGG + Intronic
1163755940 19:19106173-19106195 CCCGCACGTCTCTGCTGGGGCGG - Intronic
1164658241 19:29940359-29940381 CCACCACGCCTCTCCTGAGAAGG - Intronic
1165631454 19:37305203-37305225 CCTTCACGCCGCCACTGGGTAGG + Intergenic
1166258040 19:41619890-41619912 CCCTGACCCCTGTCCTGGCTGGG + Intronic
1166741954 19:45119862-45119884 CCCTAAAGCCCCTCCTGGGGCGG - Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
924982766 2:238170-238192 CTCTCACGCCACTCTTGGGCTGG + Intronic
925128983 2:1481279-1481301 CCCTCACACCTGTGCTGGGAAGG - Intronic
925177165 2:1793867-1793889 CCCTCCCACGACTCCTGGGTGGG + Intronic
925972134 2:9113283-9113305 AGCTCACGGTTCTCCTGGGTAGG - Intergenic
927853408 2:26513699-26513721 CCCTCCATCCTCTCCTGGGAAGG - Intronic
927998820 2:27505950-27505972 CCACCACGCCTCCCCTGGGAAGG + Intronic
930079324 2:47433613-47433635 CCCCCACCTCTCTCCTGGCTGGG + Intronic
932745981 2:74333899-74333921 CCCGCAGGCCTTTCCAGGGTAGG - Intronic
934564919 2:95333451-95333473 CCCTGACTCCTCTCCTGTGGTGG + Intronic
935898072 2:107759287-107759309 CCCTGCCGCCTCTCCTAGGGTGG + Intergenic
937872517 2:126796314-126796336 CCCTGGATCCTCTCCTGGGTGGG + Intergenic
938066880 2:128286147-128286169 CCCCCACGCCAGTCCTGGGCTGG - Intronic
938127829 2:128687131-128687153 CCCCCAAGCCTCCCCTGGCTGGG - Intergenic
938178843 2:129161834-129161856 CCCTCCCTCCTCTCCTGCTTTGG + Intergenic
947582517 2:231330468-231330490 CCCTCACACCCTTCCTGGGGTGG - Intronic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
949042089 2:241854161-241854183 CCCTCACTCGTCCCCTGGGAGGG - Intronic
1169919668 20:10721301-10721323 GTCTCATGCCTCTCCTGGGAGGG + Intergenic
1171282274 20:23910819-23910841 CACTCACCCCTTCCCTGGGTGGG + Intergenic
1171498790 20:25577305-25577327 CCCTGCCGCCTCTCCTGTGTTGG + Intronic
1174395113 20:50242578-50242600 CCCTCACCTCTGTCCTGTGTGGG - Intergenic
1176093031 20:63327392-63327414 CCACCACGTCTGTCCTGGGTGGG - Intronic
1178914603 21:36699430-36699452 CCCTCCTGCCTCTCCTGCCTCGG - Exonic
1179629278 21:42666615-42666637 TCCTGAGGCCTCTCCTGGGCTGG + Intronic
1180243737 21:46531258-46531280 CACTCACGGCTCTCCTGAGTGGG + Intronic
1182052420 22:27323655-27323677 CCCTCCCACCTCTTGTGGGTTGG - Intergenic
1182083903 22:27548336-27548358 CCCAGAGGCCTCTCTTGGGTGGG - Intergenic
1183732919 22:39628511-39628533 ACCTGAGGCCTCTCCTGGGATGG + Intronic
952341537 3:32451524-32451546 CCCTCACAACTCTGCTGGGTGGG - Intronic
954454217 3:50588383-50588405 TGCTCACGCCTCTCCTGACTGGG - Intergenic
955573364 3:60331488-60331510 CCCTCATGCCTGCCCTAGGTTGG + Intronic
960080282 3:113533436-113533458 GCCTCGCGCCTCTCCTGGCCTGG + Intronic
961521359 3:127469033-127469055 CCCTCACTCTGCTCCTGGGTGGG - Intergenic
961858175 3:129893427-129893449 CCCTCACGGCCCTCCGCGGTGGG - Intronic
962350344 3:134651533-134651555 ACCTCACTCCTTCCCTGGGTTGG + Intronic
962867582 3:139460550-139460572 CTCTGACTCCTCTCCTGGGGTGG - Intronic
966216468 3:177508217-177508239 CCCACACGGCTCTCCTAGGCTGG - Intergenic
966810337 3:183838135-183838157 CCCTCCCACCTCTCCTGAGTAGG + Intronic
967088643 3:186116203-186116225 CCTTCAGGGCTCTCCTGGGATGG - Intronic
968551323 4:1225222-1225244 CACTCAGTCCTGTCCTGGGTTGG + Intronic
969659652 4:8519040-8519062 CCATCACACCTCTGCTGGGCTGG - Intergenic
972288284 4:37668988-37669010 CCCCCACCTCTCTCCTGGATGGG - Intronic
972962672 4:44473627-44473649 CCCTCACGGCTTCCCTTGGTTGG - Intergenic
983462959 4:168049270-168049292 CCCTCCCGGCTTTCCTGGGCTGG - Intergenic
987248117 5:16070345-16070367 CCCTCACACTTCTTCTGGGACGG + Intronic
989178812 5:38556485-38556507 CCGTCTCGCCTCCCCTGTGTCGG + Intronic
989820960 5:45795661-45795683 CCCTGAAGCCTCTCCTGAGATGG - Intergenic
991223513 5:64243003-64243025 CCCTCACGCTTCCCTTGGCTAGG - Intronic
992189465 5:74276962-74276984 GCCTCACCCCTCTCCTTGGAAGG - Intergenic
995188973 5:109300525-109300547 GACTCACACCTCTTCTGGGTGGG + Intergenic
997376156 5:133399014-133399036 CCATCACTCCTCACCTCGGTGGG + Intronic
997391981 5:133524673-133524695 CCCCCACCCCGCCCCTGGGTGGG + Intronic
997884349 5:137616770-137616792 TCCTCTCCCCTCTCCTGGGCTGG - Intergenic
998135086 5:139670206-139670228 CCCCCACGCCTCTGCAGGGAGGG + Intronic
1002535094 5:179871789-179871811 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535126 5:179871883-179871905 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535141 5:179871930-179871952 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535157 5:179871977-179871999 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535173 5:179872024-179872046 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535189 5:179872071-179872093 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535205 5:179872118-179872140 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002535221 5:179872165-179872187 CCCCCACGCCCATCCTGGGAAGG - Intronic
1002988612 6:2216837-2216859 CCCACCCGCCTCTCCTGGGCAGG + Intronic
1004274339 6:14222356-14222378 CCCCCCTGTCTCTCCTGGGTGGG + Intergenic
1005399150 6:25413721-25413743 CCCTCCCACCTCCCCTGGGAAGG - Intronic
1005604558 6:27462947-27462969 CTCTAACGTCTCTTCTGGGTTGG - Intronic
1005778419 6:29162238-29162260 CCCTCATGGCTCCCCTGGCTCGG + Intergenic
1005990286 6:30898003-30898025 CTCTCTCTCCTCTCCTGGATGGG + Intronic
1006921880 6:37632838-37632860 CCCTGACCCTTCTCCTGGGCTGG + Exonic
1007492846 6:42237369-42237391 CCCTCACCCCTACCCTGGGAAGG - Intronic
1007686468 6:43670029-43670051 TCCTGAAGCCTCTCCTGAGTTGG - Intronic
1009596482 6:65744339-65744361 CACTCACCACTTTCCTGGGTTGG - Intergenic
1011915938 6:92507706-92507728 GCTCCATGCCTCTCCTGGGTGGG - Intergenic
1012525273 6:100169926-100169948 CCCTCATGCTTCTTCTGGGCAGG - Intergenic
1013048729 6:106512015-106512037 CCCGCGGGCCGCTCCTGGGTGGG - Exonic
1016574061 6:145548029-145548051 CCCTCAGGCCTTTCCTGCTTCGG + Intronic
1022076295 7:26974147-26974169 CACTCACTGCTTTCCTGGGTGGG + Intronic
1024215658 7:47246162-47246184 CCATCCCTCCTCTCCTTGGTAGG - Intergenic
1026416431 7:70185859-70185881 ATCTCACGCCTTTCCTGAGTTGG - Intronic
1027221889 7:76219481-76219503 CCCTCAGGCTTCTGCTGGGCTGG - Intronic
1029055636 7:97738560-97738582 CCCTCACGCCTGTCCAGTGTTGG + Intronic
1029580490 7:101433836-101433858 CCTTCAAGGCACTCCTGGGTTGG - Intronic
1030647723 7:112082037-112082059 TCCCCACGCCTCTCCAGCGTAGG - Intronic
1034541643 7:151762248-151762270 CCTACACGCATCTCCAGGGTGGG + Intronic
1038419343 8:27422392-27422414 CCCTGAGGCCTCTGCTGGGAGGG + Intronic
1038538195 8:28369670-28369692 CCCTCAAGCCTCCCCCAGGTGGG + Intronic
1039573237 8:38603541-38603563 CCCTCACTCCTCTTCTGGGCGGG + Intergenic
1039936892 8:42052600-42052622 CCCCGACGGCTCTCCTGTGTCGG + Intergenic
1040286008 8:46100751-46100773 CCCCCAGGGCTGTCCTGGGTGGG - Intergenic
1040290168 8:46120166-46120188 CCCTCAGGACTGTCCTGGGCGGG - Intergenic
1040291598 8:46128334-46128356 CCCCCCGGCCTCTCCTGGGCGGG - Intergenic
1040308136 8:46222870-46222892 CCCCCAGGTCTGTCCTGGGTGGG + Intergenic
1040309547 8:46229651-46229673 CCCCCAGGTCTCTCCCGGGTGGG + Intergenic
1040311149 8:46237506-46237528 CCCTCACGGCTGTCCTGGTCAGG + Intergenic
1040315045 8:46256540-46256562 CCCCCAGGGCTGTCCTGGGTGGG + Intergenic
1040316315 8:46262771-46262793 ACCTAAGGCCTGTCCTGGGTGGG + Intergenic
1040324995 8:46337175-46337197 CCCCCACGGCTCTCCTGGGCAGG + Intergenic
1040336487 8:46418657-46418679 CCCTCAGGGCTGTCCTGGGCGGG + Intergenic
1040337281 8:46422517-46422539 CCCTCAGGGCTTTCCTGGGCAGG + Intergenic
1040341978 8:46445696-46445718 CCCTCAGGGCTGTCCTGGGCAGG - Intergenic
1043167327 8:76920419-76920441 CCCTCACGCCTCCCCTGACATGG + Intergenic
1044508670 8:93049775-93049797 TCCTCATGCCACTCCTGGGTGGG + Intergenic
1046848916 8:118951665-118951687 ACCCCAAGCCTCTCCTGGGAGGG + Intronic
1049581788 8:143415339-143415361 CCCTCCTGCCTCACCTGTGTTGG - Intergenic
1051382808 9:16476032-16476054 CCCTCTAGGCTGTCCTGGGTAGG - Intronic
1055256846 9:74381950-74381972 CCCACACCCCTCTCATGAGTTGG - Intergenic
1057295139 9:93830329-93830351 TCCCCACACCTCTCCTGGCTGGG - Intergenic
1058961329 9:109995236-109995258 ACATGAGGCCTCTCCTGGGTAGG - Intronic
1059086318 9:111306485-111306507 CTCCCACGCCTTTCCTGGGCAGG + Intergenic
1059503277 9:114775152-114775174 CCCCCACCCCTCCCCTTGGTGGG + Intergenic
1062495697 9:136830567-136830589 CCCTCCGGCCTCTCCTGTCTAGG + Intronic
1185695998 X:2195148-2195170 CCTTCCCCCATCTCCTGGGTTGG - Intergenic
1186048002 X:5557040-5557062 CACTGACTCCTCTGCTGGGTTGG - Intergenic
1187515275 X:19963914-19963936 TCCTCCTGCCTCTCCTGTGTTGG - Intronic
1191068914 X:56380154-56380176 CCCCCACCTCCCTCCTGGGTGGG + Intergenic
1191255925 X:58279634-58279656 GCCTCACGACTCCCCTGGGTGGG + Intergenic
1194045184 X:88993258-88993280 TCCTCACCCCTCTCATGGGCTGG + Intergenic
1194714627 X:97275376-97275398 CCCCCACCTCCCTCCTGGGTGGG + Intronic
1197121996 X:122905099-122905121 CACTCACCACTTTCCTGGGTGGG - Intergenic
1199613925 X:149640186-149640208 TCCTCACTCATCTCCTGGGGTGG + Intergenic
1199616431 X:149659622-149659644 TCCTCACGCCCCTCCTGGGGTGG - Intergenic
1199626210 X:149743626-149743648 TCCTCACGCCCCTCCTGGGGTGG + Intergenic
1200077047 X:153556430-153556452 CCCACACCCCTTTCCTGGGGTGG + Intronic
1200209349 X:154339817-154339839 CTCTCACCTCTCACCTGGGTTGG - Intergenic
1200221527 X:154392310-154392332 CTCTCACCTCTCACCTGGGTTGG + Intronic
1200249800 X:154546913-154546935 CCCGCACGCCTCGCCTGAGGCGG - Exonic
1202070855 Y:20990291-20990313 CCCTCTCTCATGTCCTGGGTAGG - Intergenic