ID: 1152659813

View in Genome Browser
Species Human (GRCh38)
Location 17:81537032-81537054
Sequence GCGGGCCGATGCCGACGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152659802_1152659813 20 Left 1152659802 17:81536989-81537011 CCCGGAGCGGCAAGTACCTGCGC 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1152659803_1152659813 19 Left 1152659803 17:81536990-81537012 CCGGAGCGGCAAGTACCTGCGCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1152659808_1152659813 4 Left 1152659808 17:81537005-81537027 CCTGCGCGGCGGCGCCTCGGGCC 0: 1
1: 0
2: 1
3: 27
4: 223
Right 1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1152659811_1152659813 -10 Left 1152659811 17:81537019-81537041 CCTCGGGCCTGCTGCGGGCCGAT 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1152659800_1152659813 29 Left 1152659800 17:81536980-81537002 CCATCCGCGCCCGGAGCGGCAAG 0: 1
1: 0
2: 0
3: 8
4: 41
Right 1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1152659801_1152659813 25 Left 1152659801 17:81536984-81537006 CCGCGCCCGGAGCGGCAAGTACC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152659813 Original CRISPR GCGGGCCGATGCCGACGCCC CGG Exonic
900642174 1:3692932-3692954 GCTGGCCATTGCTGACGCCCAGG - Intronic
906528935 1:46512257-46512279 GCGGGGCCATGTTGACGCCCAGG - Exonic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
922744919 1:228038265-228038287 GCCCGCCGGAGCCGACGCCCGGG - Intronic
1062854589 10:773648-773670 GCTGGCCGCTGCCGGGGCCCAGG - Intergenic
1073379442 10:103066585-103066607 GCCGGCCGCTGCCGCCACCCTGG + Intronic
1076371736 10:129959772-129959794 GCGGGGCGCTGGCGACGCCGCGG - Intronic
1084150279 11:67284962-67284984 GCGGGGCGAGGGCGAGGCCCCGG + Exonic
1085296403 11:75434115-75434137 GAGGGCCCATGCCCATGCCCAGG - Intergenic
1091740727 12:2959177-2959199 GGGGGCCGCAGCCGAGGCCCGGG + Intergenic
1097938619 12:65279299-65279321 GCGGGCCGGTTCCCACGCCTCGG - Intronic
1103828710 12:123762146-123762168 GCGAGCCGCAGCCCACGCCCCGG - Intergenic
1105472001 13:20703514-20703536 GCGGGCGGATGACGAGGCGCAGG + Intronic
1108648021 13:52450077-52450099 GCTGTCCGGTGCCGACGCCGAGG + Intronic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1112091670 13:96090368-96090390 GCGGCCCGCTCCCGCCGCCCCGG - Intergenic
1116828256 14:49693044-49693066 GCGGGACGTTGCAGACGCACTGG + Intergenic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1121644155 14:95506489-95506511 GCTGGCCGATGCTCATGCCCTGG - Intergenic
1122620868 14:103057182-103057204 GCGGCCCGCTCCCGACGCGCCGG + Exonic
1122931003 14:104933094-104933116 GCGGGCGGTTTGCGACGCCCGGG - Exonic
1124392223 15:29269594-29269616 GCGGGCCGGGGAAGACGCCCGGG - Exonic
1131154885 15:90068608-90068630 GCAGGCAGATGCCCAGGCCCTGG - Intronic
1145750790 17:27353860-27353882 GAGGGCGGAGGCCGCCGCCCCGG - Intergenic
1151370750 17:73644921-73644943 GCGGGCTGTCGCCGGCGCCCGGG + Intergenic
1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG + Exonic
1160948076 19:1652539-1652561 GCGGGCCGGAGCCGACGCGGCGG - Intronic
1164977013 19:32581104-32581126 TCGGGCCTCTGCCGGCGCCCTGG + Exonic
1167570633 19:50286532-50286554 GCGGGCCGAGGCAGAGGGCCGGG + Exonic
933816123 2:86070050-86070072 CCGGGCCGAGGCCTACGTCCTGG - Exonic
936600415 2:113889937-113889959 GGCCGCCGGTGCCGACGCCCCGG - Intergenic
937208665 2:120253118-120253140 GCCGGCGGAGGGCGACGCCCCGG + Intronic
938063298 2:128268212-128268234 GCGGGAGGATGCCGACGAGCCGG - Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
949023887 2:241755959-241755981 GCGGGCCGAGGCGGGCGCGCAGG - Exonic
1168777760 20:462300-462322 GCAGGCCGCTCCCGGCGCCCCGG + Intronic
1169483514 20:6006495-6006517 GGGCGCCGCTGCCGAAGCCCCGG + Exonic
1174376436 20:50129484-50129506 GGGGGCAGAGGCCGACCCCCAGG - Intronic
1174658606 20:52191869-52191891 GCGGGCGAATCCCGAGGCCCAGG + Exonic
1179529939 21:42011132-42011154 GCGGGCCGCTGTGGACGCCCCGG - Intergenic
1179965345 21:44801669-44801691 GCGGGACGCTGCTGACGGCCCGG + Intronic
1180187105 21:46145434-46145456 GCTGGTGGATGCCGACGCCGAGG - Exonic
1184072177 22:42153038-42153060 GCGGCCCGATGCCCAGGACCTGG + Intergenic
1184769161 22:46587863-46587885 GCGGCCCCACCCCGACGCCCGGG - Intronic
950282515 3:11719833-11719855 CCGGGCCGATGCCGGCGCGCTGG + Intronic
950487705 3:13282754-13282776 GCGGGCCGGGGCCGGGGCCCGGG + Intergenic
953022939 3:39127447-39127469 GCTGGCAGATGCCGGCACCCAGG - Intronic
954152088 3:48662714-48662736 CCGGGCCCCTGCCGCCGCCCCGG + Exonic
954692361 3:52402353-52402375 GCCGGCCGATGCTGACCCCTTGG + Exonic
956632248 3:71328199-71328221 GCGGGCAGATGGCCAAGCCCAGG + Intronic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
966886398 3:184380031-184380053 ACGGGCCGGAGCCGGCGCCCGGG + Intronic
969368666 4:6716443-6716465 GCGGCCCGAGGTCGAGGCCCTGG + Exonic
969474248 4:7412262-7412284 GCAGGCCGATGGCCACCCCCTGG + Intronic
993770273 5:91917375-91917397 GCGGGCCGGCCCCGCCGCCCGGG + Intergenic
997899706 5:137753778-137753800 GCGGCCCGGTGCCCACGCCAAGG - Exonic
1001289423 5:170446101-170446123 GCTGGCCGATACAGTCGCCCAGG + Intronic
1002352162 5:178590568-178590590 GGGGGCGGGTGCCGGCGCCCGGG - Intergenic
1007614475 6:43171997-43172019 GGTGGCCGCTGCCGACGCCTCGG - Exonic
1011277131 6:85642635-85642657 GCGGGCCGCGGCCTACTCCCAGG + Intronic
1020270193 7:6590163-6590185 GCGGGCGGGTGCCGCAGCCCAGG + Exonic
1021743238 7:23710081-23710103 GCTGGCTGCTGCCGACCCCCAGG - Intergenic
1022106172 7:27199519-27199541 GCGGGCCCATGCGGGCGCACGGG + Exonic
1028160132 7:87475779-87475801 GCGGGCCGCGGCCCTCGCCCTGG - Intronic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1037884304 8:22588417-22588439 GTGGGCCGATGCCCAGGGCCAGG - Intronic
1042956765 8:74259463-74259485 GAAGGCCGATGCCGCCGACCAGG - Exonic
1049668511 8:143859327-143859349 CCGGGCCGAGGCCGAGGCCGAGG - Exonic
1049682476 8:143925785-143925807 GCTGGCCGAGGCGCACGCCCAGG - Exonic
1049773339 8:144393770-144393792 GCAGCCCGATGCCGCCGTCCAGG + Exonic
1054381768 9:64498615-64498637 GTGGGCCCATGCCGAAGGCCTGG - Intergenic
1061183785 9:129040295-129040317 GCGGGCAGATGCAGAGGCCTGGG + Intronic
1062332645 9:136051386-136051408 GCGGGCCAATCCCGACGGCCCGG + Intronic
1203773689 EBV:61559-61581 GCGGGCGGAGGCCGAGGCCGTGG - Intergenic
1192166315 X:68829548-68829570 GGGGGCCGAAGCCCATGCCCGGG + Exonic
1200075023 X:153546596-153546618 GCTGGCAGGTGCCGACACCCTGG + Intronic