ID: 1152660067

View in Genome Browser
Species Human (GRCh38)
Location 17:81537945-81537967
Sequence CTGTGGATGTGGACGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152660067_1152660081 7 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660081 17:81537975-81537997 CACGGCGGGAGGCAGAGGCTAGG No data
1152660067_1152660075 -8 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660075 17:81537960-81537982 ATCCACAGCCTGGGGCACGGCGG No data
1152660067_1152660085 20 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660085 17:81537988-81538010 AGAGGCTAGGAAGCGGAGGGTGG No data
1152660067_1152660080 2 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660080 17:81537970-81537992 TGGGGCACGGCGGGAGGCAGAGG No data
1152660067_1152660087 22 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660087 17:81537990-81538012 AGGCTAGGAAGCGGAGGGTGGGG No data
1152660067_1152660076 -7 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660076 17:81537961-81537983 TCCACAGCCTGGGGCACGGCGGG No data
1152660067_1152660090 29 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660090 17:81537997-81538019 GAAGCGGAGGGTGGGGTGGGAGG No data
1152660067_1152660086 21 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660086 17:81537989-81538011 GAGGCTAGGAAGCGGAGGGTGGG No data
1152660067_1152660084 17 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660084 17:81537985-81538007 GGCAGAGGCTAGGAAGCGGAGGG No data
1152660067_1152660089 26 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660089 17:81537994-81538016 TAGGAAGCGGAGGGTGGGGTGGG No data
1152660067_1152660083 16 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660083 17:81537984-81538006 AGGCAGAGGCTAGGAAGCGGAGG No data
1152660067_1152660088 25 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660088 17:81537993-81538015 CTAGGAAGCGGAGGGTGGGGTGG No data
1152660067_1152660078 -4 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660078 17:81537964-81537986 ACAGCCTGGGGCACGGCGGGAGG No data
1152660067_1152660082 13 Left 1152660067 17:81537945-81537967 CCCACTTCCGTCCACATCCACAG No data
Right 1152660082 17:81537981-81538003 GGGAGGCAGAGGCTAGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152660067 Original CRISPR CTGTGGATGTGGACGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr